miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-129-2-3p | ||||
| miRNA Stemloop AC | MI0000473 | ||||
| miRNA Stemloop ID | hsa-mir-129-2 | ||||
| Sequence | aagcccuuaccccaaaaagcau | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | |
| Apoptosis regulator Bcl-W (BCL-W) | Clinical trial Target | Target Info | [2] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Centriolar coiled-coil protein of 110 kDa | Regulated Protein | [4] | ||
| NEDD8-conjugating enzyme UBE2F | Regulated Protein | [5] | |||
| Ras association domain-containing protein 1 | Regulated Protein | [6] | |||
| Transcription factor SOX-4 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | Growth inhibitory effects of three miR-129 family members on gastric cancer. Gene. 2013 Dec 10;532(1):87-93. | ||||
| REF 2 | Downregulation of miR-129-2 by promoter hypermethylation regulates breast cancer cell proliferation and apoptosis. Oncol Rep. 2016 May;35(5):2963-9. | ||||
| REF 3 | Prediction and preliminary validation of oncogene regulation by miRNAs. BMC Mol Biol. 2007 Sep 18;8:79. | ||||
| REF 4 | miR-129-3p controls cilia assembly by regulating CP110 and actin dynamics.Nat Cell Biol. 2012 Jun 10;14(7):697-706. | ||||
| REF 5 | Epigenetic repression of microRNA-129-2 leads to overexpression of SOX4 oncogene in endometrial cancer.Cancer Res. 2009 Dec 1;69(23):9038-46. | ||||
| REF 6 | Expression and DNA methylation alterations of seven cancer-associated 3p genes and their predicted regulator miRNAs (miR-129-2, miR-9-1) in breast and ovarian cancers.Gene. 2016 Jan 15;576(1 Pt 3):483-91. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.