miRNA General Information
miRNA Mature ID	hsa-miR-148b-5p
miRNA Stemloop AC	MI0000811
miRNA Stemloop ID	hsa-mir-148b
Sequence	aaguucuguuauacacucaggc
TTD Target(s) Regulated by This miRNA	Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1)	Clinical trial Target	Target Info	[1]
References
REF 1	A microRNA screen to identify modulators of sensitivity to BCL2 inhibitor ABT-263 (navitoclax). Mol Cancer Ther. 2010 Nov;9(11):2943-50.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.