miRNA General Information
miRNA Mature ID hsa-miR-183-5p
miRNA Stemloop AC MI0000273
miRNA Stemloop ID hsa-mir-183
Sequence uauggcacugguagaauucacu
TTD Target(s) Regulated by This miRNA Isocitrate dehydrogenase (IDH) Successful Target Target Info [1]
Glycogen synthase kinase-3 beta (GSK-3B) Clinical trial Target Target Info [2]
Integrin beta-1 (ITGB1) Clinical trial Target Target Info [3]
Dickkopf-related protein 3 (DKK3) Clinical trial Target Target Info [4]
Early growth response protein 1 (EGR-1) Clinical trial Target Target Info [5]
LDL receptor related protein-6 (LRP-6) Clinical trial Target Target Info [6]
Forkhead box protein O1A (FOXO1) Literature-reported Target Target Info [7]
Polycomb complex protein BMI-1 (BMI1) Clinical trial Target Target Info [8]
Suppressor of tumorigenicity 15 protein (ST15) Literature-reported Target Target Info [9]
Protein(s) Regulated by This miRNA A-kinase anchor protein 12 Regulated Protein [10]
Death-associated protein 1 Regulated Protein [11]
Ezrin Regulated Protein [12]
F-box/WD repeat-containing protein 1A Regulated Protein [13]
Kinesin-like protein KIF2A Regulated Protein [3]
Mothers against decapentaplegic homolog 4 Regulated Protein [4]
Nuclear factor interleukin-3-regulated protein Regulated Protein [16]
PCNA-associated factor Regulated Protein [17]
Programmed cell death protein 4 Regulated Protein [11]
Programmed cell death protein 6 Regulated Protein [11]
Serine/arginine-rich splicing factor 2 Regulated Protein [18]
Serine/threonine-protein phosphatase 2A activator Regulated Protein [19]
Serine/threonine-protein phosphatase 2A catalytic subunit beta isoform Regulated Protein [19]
Serotonin N-acetyltransferase Regulated Protein [16]
Suppressor of cytokine signaling 6 Regulated Protein [20]
UV radiation resistance-associated gene protein Regulated Protein [21]
Zinc finger E-box-binding homeobox 1 Regulated Protein [22]
Zinc finger protein SNAI2 Regulated Protein [22]
Zinc finger protein ZFPM1 Regulated Protein [23]
References
REF 1 MicroRNA-183 upregulates HIF-1 by targeting isocitrate dehydrogenase 2 (IDH2) in glioma cells. J Neurooncol. 2013 Feb;111(3):273-83.
REF 2 Glycogen synthase kinase 3 beta inhibits microRNA-183-96-182 cluster via the -Catenin/TCF/LEF-1 pathway in gastric cancer cells. Nucleic Acids Res. 2014 Mar;42(5):2988-98.
REF 3 Targeting of integrin beta1 and kinesin 2alpha by microRNA 183. J Biol Chem. 2010 Feb 19;285(8):5461-71.
REF 4 microRNA-183 is an oncogene targeting Dkk-3 and SMAD4 in prostate cancer. Br J Cancer. 2013 Apr 30;108(8):1659-67.
REF 5 MicroRNA miR-183 functions as an oncogene by targeting the transcription factor EGR1 and promoting tumor cell migration. Cancer Res. 2010 Dec 1;70(23):9570-80.
REF 6 MicroRNA-183 suppresses retinoblastoma cell growth, invasion and migration by targeting LRP6. FEBS J. 2014 Mar;281(5):1355-65.
REF 7 Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells. J Biol Chem. 2009 Aug 28;284(35):23204-16.
REF 8 MicroRNA-183 inhibits gastric cancer proliferation and invasion via directly targeting Bmi-1. Oncol Lett. 2014 Nov;8(5):2345-2351.
REF 9 MicroRNA miR-182 cluster mediated modulation of RECK without changes in cell surface membrane type-1 matrix metalloproteinase (MT1-MMP). Am J Cancer Res. 2015 Aug 15;5(9):2918-28.
REF 10 Down-regulation of tumor suppressor A kinase anchor protein 12 in human hepatocarcinogenesis by epigenetic mechanisms.Hepatology. 2010 Dec;52(6):2023-33.
REF 11 miR-183 inhibits TGF-beta1-induced apoptosis by downregulation of PDCD4 expression in human hepatocellular carcinoma cells.BMC Cancer. 2010 Jul 6;10:354.
REF 12 MicroRNA-183 regulates Ezrin expression in lung cancer cells.FEBS Lett. 2008 Oct 29;582(25-26):3663-8.
REF 13 CRD-BP protects the coding region of betaTrCP1 mRNA from miR-183-mediated degradation.Mol Cell. 2009 Jul 31;35(2):240-6.
REF 14 Targeting of integrin beta1 and kinesin 2alpha by microRNA 183. J Biol Chem. 2010 Feb 19;285(8):5461-71.
REF 15 microRNA-183 is an oncogene targeting Dkk-3 and SMAD4 in prostate cancer. Br J Cancer. 2013 Apr 30;108(8):1659-67.
REF 16 The light-induced transcriptome of the zebrafish pineal gland reveals complex regulation of the circadian clockwork by light.Nucleic Acids Res. 2014 Apr;42(6):3750-67.
REF 17 Deregulation of miR-183 and KIAA0101 in Aggressive and Malignant Pituitary Tumors.Front Med (Lausanne). 2015 Aug 10;2:54.
REF 18 Changes in brain MicroRNAs contribute to cholinergic stress reactions.J Mol Neurosci. 2010 Jan;40(1-2):47-55.
REF 19 microRNA-183 plays as oncogenes by increasing cell proliferation, migration and invasion via targeting protein phosphatase 2A in renal cancer cells.Biochem Biophys Res Commun. 2014 Sep 12;452(1):163-9.
REF 20 MicroRNA-183-5p promotes the proliferation, invasion and metastasis of human pancreatic adenocarcinoma cells. Oncol Lett. 2016 Jan;11(1):134-140.
REF 21 miR-183 regulates autophagy and apoptosis in colorectal cancer through targeting of UVRAG.Oncotarget. 2016 Jan 26;7(4):4735-45.
REF 22 A p21-ZEB1 complex inhibits epithelial-mesenchymal transition through the microRNA 183-96-182 cluster.Mol Cell Biol. 2014 Feb;34(3):533-50.
REF 23 ZEB1 sensitizes lung adenocarcinoma to metastasis suppression by PI3K antagonism. J Clin Invest. 2014 Jun;124(6):2696-708.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.