miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-183-5p | ||||
miRNA Stemloop AC | MI0000273 | ||||
miRNA Stemloop ID | hsa-mir-183 | ||||
Sequence | uauggcacugguagaauucacu | ||||
TTD Target(s) Regulated by This miRNA | Isocitrate dehydrogenase (IDH) | Successful Target | Target Info | [1] | |
Glycogen synthase kinase-3 beta (GSK-3B) | Clinical trial Target | Target Info | [2] | ||
Integrin beta-1 (ITGB1) | Clinical trial Target | Target Info | [3] | ||
Dickkopf-related protein 3 (DKK3) | Clinical trial Target | Target Info | [4] | ||
Early growth response protein 1 (EGR-1) | Clinical trial Target | Target Info | [5] | ||
LDL receptor related protein-6 (LRP-6) | Clinical trial Target | Target Info | [6] | ||
Forkhead box protein O1A (FOXO1) | Literature-reported Target | Target Info | [7] | ||
Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [8] | ||
Suppressor of tumorigenicity 15 protein (ST15) | Literature-reported Target | Target Info | [9] | ||
Protein(s) Regulated by This miRNA | A-kinase anchor protein 12 | Regulated Protein | [10] | ||
Death-associated protein 1 | Regulated Protein | [11] | |||
Ezrin | Regulated Protein | [12] | |||
F-box/WD repeat-containing protein 1A | Regulated Protein | [13] | |||
Kinesin-like protein KIF2A | Regulated Protein | [3] | |||
Mothers against decapentaplegic homolog 4 | Regulated Protein | [4] | |||
Nuclear factor interleukin-3-regulated protein | Regulated Protein | [16] | |||
PCNA-associated factor | Regulated Protein | [17] | |||
Programmed cell death protein 4 | Regulated Protein | [11] | |||
Programmed cell death protein 6 | Regulated Protein | [11] | |||
Serine/arginine-rich splicing factor 2 | Regulated Protein | [18] | |||
Serine/threonine-protein phosphatase 2A activator | Regulated Protein | [19] | |||
Serine/threonine-protein phosphatase 2A catalytic subunit beta isoform | Regulated Protein | [19] | |||
Serotonin N-acetyltransferase | Regulated Protein | [16] | |||
Suppressor of cytokine signaling 6 | Regulated Protein | [20] | |||
UV radiation resistance-associated gene protein | Regulated Protein | [21] | |||
Zinc finger E-box-binding homeobox 1 | Regulated Protein | [22] | |||
Zinc finger protein SNAI2 | Regulated Protein | [22] | |||
Zinc finger protein ZFPM1 | Regulated Protein | [23] | |||
References | |||||
REF 1 | MicroRNA-183 upregulates HIF-1 by targeting isocitrate dehydrogenase 2 (IDH2) in glioma cells. J Neurooncol. 2013 Feb;111(3):273-83. | ||||
REF 2 | Glycogen synthase kinase 3 beta inhibits microRNA-183-96-182 cluster via the -Catenin/TCF/LEF-1 pathway in gastric cancer cells. Nucleic Acids Res. 2014 Mar;42(5):2988-98. | ||||
REF 3 | Targeting of integrin beta1 and kinesin 2alpha by microRNA 183. J Biol Chem. 2010 Feb 19;285(8):5461-71. | ||||
REF 4 | microRNA-183 is an oncogene targeting Dkk-3 and SMAD4 in prostate cancer. Br J Cancer. 2013 Apr 30;108(8):1659-67. | ||||
REF 5 | MicroRNA miR-183 functions as an oncogene by targeting the transcription factor EGR1 and promoting tumor cell migration. Cancer Res. 2010 Dec 1;70(23):9570-80. | ||||
REF 6 | MicroRNA-183 suppresses retinoblastoma cell growth, invasion and migration by targeting LRP6. FEBS J. 2014 Mar;281(5):1355-65. | ||||
REF 7 | Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells. J Biol Chem. 2009 Aug 28;284(35):23204-16. | ||||
REF 8 | MicroRNA-183 inhibits gastric cancer proliferation and invasion via directly targeting Bmi-1. Oncol Lett. 2014 Nov;8(5):2345-2351. | ||||
REF 9 | MicroRNA miR-182 cluster mediated modulation of RECK without changes in cell surface membrane type-1 matrix metalloproteinase (MT1-MMP). Am J Cancer Res. 2015 Aug 15;5(9):2918-28. | ||||
REF 10 | Down-regulation of tumor suppressor A kinase anchor protein 12 in human hepatocarcinogenesis by epigenetic mechanisms.Hepatology. 2010 Dec;52(6):2023-33. | ||||
REF 11 | miR-183 inhibits TGF-beta1-induced apoptosis by downregulation of PDCD4 expression in human hepatocellular carcinoma cells.BMC Cancer. 2010 Jul 6;10:354. | ||||
REF 12 | MicroRNA-183 regulates Ezrin expression in lung cancer cells.FEBS Lett. 2008 Oct 29;582(25-26):3663-8. | ||||
REF 13 | CRD-BP protects the coding region of betaTrCP1 mRNA from miR-183-mediated degradation.Mol Cell. 2009 Jul 31;35(2):240-6. | ||||
REF 14 | Targeting of integrin beta1 and kinesin 2alpha by microRNA 183. J Biol Chem. 2010 Feb 19;285(8):5461-71. | ||||
REF 15 | microRNA-183 is an oncogene targeting Dkk-3 and SMAD4 in prostate cancer. Br J Cancer. 2013 Apr 30;108(8):1659-67. | ||||
REF 16 | The light-induced transcriptome of the zebrafish pineal gland reveals complex regulation of the circadian clockwork by light.Nucleic Acids Res. 2014 Apr;42(6):3750-67. | ||||
REF 17 | Deregulation of miR-183 and KIAA0101 in Aggressive and Malignant Pituitary Tumors.Front Med (Lausanne). 2015 Aug 10;2:54. | ||||
REF 18 | Changes in brain MicroRNAs contribute to cholinergic stress reactions.J Mol Neurosci. 2010 Jan;40(1-2):47-55. | ||||
REF 19 | microRNA-183 plays as oncogenes by increasing cell proliferation, migration and invasion via targeting protein phosphatase 2A in renal cancer cells.Biochem Biophys Res Commun. 2014 Sep 12;452(1):163-9. | ||||
REF 20 | MicroRNA-183-5p promotes the proliferation, invasion and metastasis of human pancreatic adenocarcinoma cells. Oncol Lett. 2016 Jan;11(1):134-140. | ||||
REF 21 | miR-183 regulates autophagy and apoptosis in colorectal cancer through targeting of UVRAG.Oncotarget. 2016 Jan 26;7(4):4735-45. | ||||
REF 22 | A p21-ZEB1 complex inhibits epithelial-mesenchymal transition through the microRNA 183-96-182 cluster.Mol Cell Biol. 2014 Feb;34(3):533-50. | ||||
REF 23 | ZEB1 sensitizes lung adenocarcinoma to metastasis suppression by PI3K antagonism. J Clin Invest. 2014 Jun;124(6):2696-708. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.