miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-203a-5p | ||||
miRNA Stemloop AC | MI0000283 | ||||
miRNA Stemloop ID | hsa-mir-203a | ||||
Sequence | agugguucuuaacaguucaacaguu | ||||
TTD Target(s) Regulated by This miRNA | Matrix metalloproteinase-2 (MMP-2) | Successful Target | Target Info | [1] | |
Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | ||
Matrix metalloproteinase-7 (MMP-7) | Successful Target | Target Info | [1] | ||
Matrix metalloproteinase-9 (MMP-9) | Clinical trial Target | Target Info | [1] | ||
CDK inhibitor 1B p27Kip1 (CDKN1B) | Literature-reported Target | Target Info | [1] | ||
Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [1] | ||
Secreted frizzled related protein-4 (SFRP4) | Literature-reported Target | Target Info | [2] | ||
Protein(s) Regulated by This miRNA | G1/S-specific cyclin-D2 | Regulated Protein | [1] | ||
Ras-related protein Rap-1A | Regulated Protein | [4] | |||
Transmembrane 4 L6 family member 1 | Regulated Protein | [2] | |||
UV radiation resistance-associated gene protein | Regulated Protein | [6] | |||
References | |||||
REF 1 | MicroRNA-203 Regulates Growth and Metastasis of Breast Cancer. Cell Physiol Biochem. 2015;37(1):35-42. | ||||
REF 2 | miR-203 inhibits arecoline-induced epithelial-mesenchymal transition by regulating secreted frizzled-related protein 4 and transmembrane-4 L six family member 1 in oral submucous fibrosis. Oncol Rep. 2015 Jun;33(6):2753-60. | ||||
REF 3 | MicroRNA-203 Regulates Growth and Metastasis of Breast Cancer. Cell Physiol Biochem. 2015;37(1):35-42. | ||||
REF 4 | MiR-203 down-regulates Rap1A and suppresses cell proliferation, adhesion and invasion in prostate cancer.J Exp Clin Cancer Res. 2015 Jan 31;34:8. | ||||
REF 5 | miR-203 inhibits arecoline-induced epithelial-mesenchymal transition by regulating secreted frizzled-related protein 4 and transmembrane-4 L six family member 1 in oral submucous fibrosis. Oncol Rep. 2015 Jun;33(6):2753-60. | ||||
REF 6 | RBM28, a protein deficient in ANE syndrome, regulates hair follicle growth via miR-203 and p63.Exp Dermatol. 2015 Aug;24(8):618-22. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.