miRNA General Information
miRNA Mature ID hsa-miR-203a-5p
miRNA Stemloop AC MI0000283
miRNA Stemloop ID hsa-mir-203a
Sequence agugguucuuaacaguucaacaguu
TTD Target(s) Regulated by This miRNA Matrix metalloproteinase-2 (MMP-2) Successful Target Target Info [1]
Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [1]
Matrix metalloproteinase-7 (MMP-7) Successful Target Target Info [1]
Matrix metalloproteinase-9 (MMP-9) Clinical trial Target Target Info [1]
CDK inhibitor 1B p27Kip1 (CDKN1B) Literature-reported Target Target Info [1]
Melanoma differentiation-associated protein 6 (CDKN1A) Literature-reported Target Target Info [1]
Secreted frizzled related protein-4 (SFRP4) Literature-reported Target Target Info [2]
Protein(s) Regulated by This miRNA G1/S-specific cyclin-D2 Regulated Protein [1]
Ras-related protein Rap-1A Regulated Protein [4]
Transmembrane 4 L6 family member 1 Regulated Protein [2]
UV radiation resistance-associated gene protein Regulated Protein [6]
References
REF 1 MicroRNA-203 Regulates Growth and Metastasis of Breast Cancer. Cell Physiol Biochem. 2015;37(1):35-42.
REF 2 miR-203 inhibits arecoline-induced epithelial-mesenchymal transition by regulating secreted frizzled-related protein 4 and transmembrane-4 L six family member 1 in oral submucous fibrosis. Oncol Rep. 2015 Jun;33(6):2753-60.
REF 3 MicroRNA-203 Regulates Growth and Metastasis of Breast Cancer. Cell Physiol Biochem. 2015;37(1):35-42.
REF 4 MiR-203 down-regulates Rap1A and suppresses cell proliferation, adhesion and invasion in prostate cancer.J Exp Clin Cancer Res. 2015 Jan 31;34:8.
REF 5 miR-203 inhibits arecoline-induced epithelial-mesenchymal transition by regulating secreted frizzled-related protein 4 and transmembrane-4 L six family member 1 in oral submucous fibrosis. Oncol Rep. 2015 Jun;33(6):2753-60.
REF 6 RBM28, a protein deficient in ANE syndrome, regulates hair follicle growth via miR-203 and p63.Exp Dermatol. 2015 Aug;24(8):618-22.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.