miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-23a-3p
miRNA Stemloop AC MI0000079
miRNA Stemloop ID hsa-mir-23a
Sequence aucacauugccagggauuucc
TTD Target(s) Regulated by This miRNA Heat shock protein 90 alpha (HSP90A) Successful Target Target Info [1]
DNA topoisomerase I (TOP1) Successful Target Target Info [2]
Interleukin-8 (IL8) Successful Target Target Info [3]
Signal transducer and activator of transcription 3 (STAT3) Successful Target Target Info [4]
Mothers against decapentaplegic homolog 3 (SMAD3) Successful Target Target Info [5]
Lysophosphatidic acid receptor 1 (LPAR1) Clinical trial Target Target Info [6]
Protein-tyrosine phosphatase SHP-2 (PTPN11) Clinical trial Target Target Info [7]
Apoptosis mediating surface antigen FAS (FAS) Clinical trial Target Target Info [8]
X-linked inhibitor of apoptosis protein (XIAP) Clinical trial Target Target Info [9]
Gap junction alpha-1 protein (GJA1) Clinical trial Target Target Info [10]
Stromal cell-derived factor 1 (CXCL12) Clinical trial Target Target Info [11]
Glutaminase (GLS) Clinical trial Target Target Info [12]
Inhibitor of nuclear factor kappa-B kinase alpha (IKKA) Literature-reported Target Target Info [13]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [14]
Lactate dehydrogenase A (LDHA) Literature-reported Target Target Info [15]
Forkhead box protein M1 (FOXM1) Literature-reported Target Target Info [16]
Glucose-6-phosphatase (G6PC) Clinical trial Target Target Info [17]
NIMA-related kinase 6 (NEK6) Literature-reported Target Target Info [18]
Epithelial cadherin (CDH1) Literature-reported Target Target Info [19]
Lysosome-associated membrane glycoprotein 1 (CD107a) Literature-reported Target Target Info [20]
Myosin-2 (MYH2) Literature-reported Target Target Info [21]
Telomeric repeat-binding factor 2 (TERF2) Literature-reported Target Target Info [22]
High-mobility group protein B2 (HMGB2) Literature-reported Target Target Info [23]
Interferon regulatory factor 1 (IRF1) Literature-reported Target Target Info [24]
Protein(s) Regulated by This miRNA Alpha-tubulin N-acetyltransferase 1 Regulated Protein
ATAT_HUMAN
[25]
Apoptotic protease-activating factor 1 Regulated Protein
APAF_HUMAN
[26]
E3 ubiquitin-protein ligase TRIM63 Regulated Protein
TRI63_HUMAN
[27]
Fanconi anemia group G protein Regulated Protein
FANCG_HUMAN
[28]
Forkhead box protein O3 Regulated Protein
FOXO3_HUMAN
[29]
Forkhead box protein O3 Regulated Protein
FOXO3_HUMAN
[30]
Frizzled-5 Regulated Protein
FZD5_HUMAN
[31]
Hamartin Regulated Protein
TSC1_HUMAN
[32]
Hepatocyte nuclear factor 1-beta Regulated Protein
HNF1B_HUMAN
[31]
Hepatocyte nuclear factor 3-alpha Regulated Protein
FOXA1_HUMAN
[33]
Histidine-rich glycoprotein Regulated Protein
HRG_HUMAN
[16]
Homeobox protein Hox-B4 Regulated Protein
HXB4_HUMAN
[35]
Huntingtin-interacting protein 1-related protein Regulated Protein
HIP1R_HUMAN
[36]
Interleukin-6 receptor subunit alpha Regulated Protein
IL6RA_HUMAN
[37]
Krueppel-like factor 3 Regulated Protein
KLF3_HUMAN
[38]
L-lactate dehydrogenase B chain Regulated Protein
LDHB_HUMAN
[15]
Low-density lipoprotein receptor-related protein 5 Regulated Protein
LRP5_HUMAN
[40]
Metallothionein-2 Regulated Protein
MT2_HUMAN
[41]
Mothers against decapentaplegic homolog 5 Regulated Protein
SMAD5_HUMAN
[42]
Myocyte-specific enhancer factor 2C Regulated Protein
MEF2C_HUMAN
[43]
Myosin-1 Regulated Protein
MYH1_HUMAN
[21]
Myosin-4 Regulated Protein
MYH4_HUMAN
[21]
Non-histone chromosomal protein HMG-17 Regulated Protein
HMGN2_HUMAN
[45]
Peroxisome proliferator-activated receptor gamma coactivator 1-alpha Regulated Protein
PRGC1_HUMAN
[17]
POU domain, class 4, transcription factor 2 Regulated Protein
PO4F2_HUMAN
[11]
Protein sprouty homolog 2 Regulated Protein
SPY2_HUMAN
[48]
Regulator of G-protein signaling 5 Regulated Protein
RGS5_HUMAN
[49]
Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit epsilon isoform Regulated Protein
2A5E_HUMAN
[50]
Suppressor of tumorigenicity 7 protein-like Regulated Protein
ST7L_HUMAN
[13]
Transcription factor HES-1 Regulated Protein
HES1_HUMAN
[52]
Transmembrane protein 64 Regulated Protein
TMM64_HUMAN
[53]
References
REF 1 Up-regulation of miR-21 and miR-23a Contributes to As2 O3 -induced hERG Channel Deficiency. Basic Clin Pharmacol Toxicol. 2015 Jun;116(6):516-23.
REF 2 MiR-23a regulates DNA damage repair and apoptosis in UVB-irradiated HaCaT cells. J Dermatol Sci. 2013 Jan;69(1):68-76.
REF 3 Integrated analysis of differential miRNA and mRNA expression profiles in human radioresistant and radiosensitive nasopharyngeal carcinoma cells. PLoS One. 2014 Jan 31;9(1):e87767.
REF 4 MiR-23a sensitizes nasopharyngeal carcinoma to irradiation by targeting IL-8/Stat3 pathway. Oncotarget. 2015 Sep 29;6(29):28341-56.
REF 5 MicroRNA-23a-3p promotes the development of osteoarthritis by directly targeting SMAD3 in chondrocytes. Biochem Biophys Res Commun. 2016 Sep 9;478(1):467-473.
REF 6 Reciprocal regulation of miR-23a and lysophosphatidic acid receptor signaling in cardiomyocyte hypertrophy. Biochim Biophys Acta. 2013 Aug;1831(8):1386-94.
REF 7 A comprehensive analysis of GATA-1-regulated miRNAs reveals miR-23a to be a positive modulator of erythropoiesis. Nucleic Acids Res. 2013 Apr;41(7):4129-43.
REF 8 MicroRNA-23a modulates tumor necrosis factor-alpha-induced osteoblasts apoptosis by directly targeting Fas. J Cell Biochem. 2013 Dec;114(12):2738-45.
REF 9 Estradiol induces apoptosis via activation of miRNA-23a and p53: implication for gender difference in liver cancer development. Oncotarget. 2015 Oct 27;6(33):34941-52.
REF 10 miR-23a impairs bone differentiation in osteosarcoma via down-regulation of GJA1. Front Genet. 2015 Jul 2;6:233.
REF 11 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 12 Inhibition of the oxidative stress-induced miR-23a protects the human retinal pigment epithelium (RPE) cells from apoptosis through the upregulation of glutaminase and glutamine uptake. Mol Biol Rep. 2016 Oct;43(10):1079-87.
REF 13 miR-23a promotes IKK expression but suppresses ST7L expression to contribute to the malignancy of epithelial ovarian cancer cells. Br J Cancer. 2016 Sep 6;115(6):731-40.
REF 14 cAMP response element-binding protein promotes gliomagenesis by modulating the expression of oncogenic microRNA-23a. Proc Natl Acad Sci U S A. 2012 Sep 25;109(39):15805-10.
REF 15 Estrogen and retinoic acid antagonistically regulate several microRNA genes to control aerobic glycolysis in breast cancer cells. Mol Biosyst. 2012 Oct 30;8(12):3242-53.
REF 16 Breast tissue-based microRNA panel highlights microRNA-23a and selected target genes as putative biomarkers for breast cancer. Transl Res. 2015 Mar;165(3):417-27.
REF 17 Stat3-mediated activation of microRNA-23a suppresses gluconeogenesis in hepatocellular carcinoma by down-regulating glucose-6-phosphatase and peroxisome proliferator-activated receptor gamma, coactivator 1 alpha. Hepatology. 2012 Jul;56(1):186-97.
REF 18 Berberine-induced tumor suppressor p53 up-regulation gets involved in the regulatory network of MIR-23a in hepatocellular carcinoma. Biochim Biophys Acta. 2014 Sep;1839(9):849-57.
REF 19 MiR-23a regulates TGF--induced epithelial-mesenchymal transition by targeting E-cadherin in lung cancer cells. Int J Oncol. 2012 Sep;41(3):869-75.
REF 20 The TGF--inducible miR-23a cluster attenuates IFN- levels and antigen-specific cytotoxicity in human CD8 T cells. J Leukoc Biol. 2014 Oct;96(4):633-45.
REF 21 MiR-23a inhibits myogenic differentiation through down regulation of fast myosin heavy chain isoforms. Exp Cell Res. 2012 Nov 1;318(18):2324-34.
REF 22 Mir-23a induces telomere dysfunction and cellular senescence by inhibiting TRF2 expression. Aging Cell. 2015 Jun;14(3):391-9.
REF 23 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 24 miR-23a targets interferon regulatory factor 1 and modulates cellular proliferation and paclitaxel-induced apoptosis in gastric adenocarcinoma cells. PLoS One. 2013 Jun 10;8(6):e64707.
REF 25 A combined computational-experimental approach predicts human microRNA targets. Genes Dev. 2004 May 15;18(10):1165-78.
REF 26 MicroRNA-23a antisense enhances 5-fluorouracil chemosensitivity through APAF-1/caspase-9 apoptotic pathway in colorectal cancer cells.J Cell Biochem. 2014 Apr;115(4):772-84.
REF 27 Delphinidin Prevents Muscle Atrophy and Upregulates miR-23a Expression.J Agric Food Chem. 2017 Jan 11;65(1):45-50.
REF 28 Areca nut induces miR-23a and inhibits repair of DNA double-strand breaks by targeting FANCG.Toxicol Sci. 2011 Oct;123(2):480-90.
REF 29 Cardiac hypertrophy is positively regulated by MicroRNA miR-23a.J Biol Chem. 2012 Jan 2;287(1):589-99.
REF 30 MiR-17-92 cluster regulates cell proliferation and collagen synthesis by targeting TGFB pathway in mouse palatal mesenchymal cells.J Cell Biochem. 2012 Apr;113(4):1235-44.
REF 31 MiR-23a/-24-induced gene silencing results in mesothelial cell integration of pancreatic cancer.Br J Cancer. 2015 Jan 6;112(1):131-9.
REF 32 Cortical Tubers: Windows into Dysregulation of Epilepsy Risk and Synaptic Signaling Genes by MicroRNAs.Cereb Cortex. 2016 Mar;26(3):1059-71.
REF 33 Metformin induces apoptosis of human hepatocellular carcinoma HepG2 cells by activating an AMPK/p53/miR-23a/FOXA1 pathway.Onco Targets Ther. 2016 May 12;9:2845-53.
REF 34 Breast tissue-based microRNA panel highlights microRNA-23a and selected target genes as putative biomarkers for breast cancer. Transl Res. 2015 Mar;165(3):417-27.
REF 35 Identification of the transcription factor HOXB4 as a novel target of miR-23a.Genes Chromosomes Cancer. 2013 Aug;52(8):709-15.
REF 36 The microRNA-23b/-27b cluster suppresses prostate cancer metastasis via Huntingtin-interacting protein 1-related.Oncogene. 2016 Sep 8;35(36):4752-61.
REF 37 MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor.FEBS J. 2010 Sep;277(18):3726-34.
REF 38 A feedback loop consisting of microRNA 23a/27a and the -like globin suppressors KLF3 and SP1 regulates globin gene expression. Mol Cell Biol. 2013 Oct;33(20):3994-4007.
REF 39 Estrogen and retinoic acid antagonistically regulate several microRNA genes to control aerobic glycolysis in breast cancer cells. Mol Biosyst. 2012 Oct 30;8(12):3242-53.
REF 40 microRNA-23a inhibits osteogenic differentiation of human bone marrow-derived mesenchymal stem cells by targeting LRP5.Int J Biochem Cell Biol. 2016 Mar;72:55-62.
REF 41 MiR-23a in amplified 19p13.13 loci targets metallothionein 2A and promotes growth in gastric cancer cells.J Cell Biochem. 2013 Sep;114(9):2160-9.
REF 42 miR-23a and miR-27a promote human granulosa cell apoptosis by targeting SMAD5.Biol Reprod. 2015 Oct;93(4):98.
REF 43 MicroRNA-23a reduces slow myosin heavy chain isoforms composition through myocyte enhancer factor 2C (MEF2C) and potentially influences meat quality.Meat Sci. 2016 Jun;116:201-6.
REF 44 MiR-23a inhibits myogenic differentiation through down regulation of fast myosin heavy chain isoforms. Exp Cell Res. 2012 Nov 1;318(18):2324-34.
REF 45 An integrated expression profiling reveals target genes of TGF- and TNF- possibly mediated by microRNAs in lung cancer cells.PLoS One. 2013;8(2):e56587.
REF 46 Stat3-mediated activation of microRNA-23a suppresses gluconeogenesis in hepatocellular carcinoma by down-regulating glucose-6-phosphatase and peroxisome proliferator-activated receptor gamma, coactivator 1 alpha. Hepatology. 2012 Jul;56(1):186-97.
REF 47 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 48 c-MYC-regulated miR-23a/24-2/27a cluster promotes mammary carcinoma cell invasion and hepatic metastasis by targeting Sprouty2.J Biol Chem. 2013 Jun 21;288(25):18121-33.
REF 49 MicroRNAs that target RGS5.Iran J Basic Med Sci. 2015 Feb;18(2):108-14.
REF 50 Downregulation of PPP2R5E expression by miR-23a suppresses apoptosis to facilitate the growth of gastric cancer cells.FEBS Lett. 2014 Aug 25;588(17):3160-9.
REF 51 miR-23a promotes IKK expression but suppresses ST7L expression to contribute to the malignancy of epithelial ovarian cancer cells. Br J Cancer. 2016 Sep 6;115(6):731-40.
REF 52 Hes1 is a target of microRNA-23 during retinoic-acid-induced neuronal differentiation of NT2 cells.Nature. 2003 Jun 19;423(6942):838-42.
REF 53 miR-23a/b regulates the balance between osteoblast and adipocyte differentiation in bone marrow mesenchymal stem cells.Bone Res. 2016 Aug 24;4:16022.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.