miRNA General Information
miRNA Mature ID hsa-miR-23b-3p
miRNA Stemloop AC MI0000439
miRNA Stemloop ID hsa-mir-23b
Sequence aucacauugccagggauuaccac
miRNA General Information
miRNA Mature ID hsa-miR-23b-3p
miRNA Stemloop AC MI0000439
miRNA Stemloop ID hsa-mir-23b
Sequence aucacauugccagggauuacc
TTD Target(s) Regulated by This miRNA Carbonic anhydrase II (CA-II) Successful Target Target Info [1]
Proto-oncogene c-Src (SRC) Successful Target Target Info [2]
Proto-oncogene c-Met (MET) Successful Target Target Info [3]
Urokinase-type plasminogen activator (PLAU) Successful Target Target Info [4]
NAD-dependent deacetylase sirtuin-1 (SIRT1) Clinical trial Target Target Info [5]
Gap junction alpha-1 protein (GJA1) Clinical trial Target Target Info [6]
Notch-1 receptor (NOTCH1) Clinical trial Target Target Info [7]
Notch-2 receptor (NOTCH2) Clinical trial Target Target Info [8]
E2F transcription factor 1 (E2F1) Clinical trial Target Target Info [9]
Myristoylated alanine-rich C-kinase substrate (MARCKS) Clinical trial Target Target Info [10]
von Hippel-Lindau disease tumor suppressor (VHL) Patented-recorded Target Target Info [11]
Activin receptor type IIB (ACVR2B) Literature-reported Target Target Info [12]
Focal adhesion kinase 2 (PTK2B) Literature-reported Target Target Info [13]
Inhibitor of nuclear factor kappa-B kinase alpha (IKKA) Literature-reported Target Target Info [14]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [15]
Protein C-ets-1 (ETS1) Literature-reported Target Target Info [8]
High mobility group protein HMGI-C (HMGA2) Literature-reported Target Target Info [16]
High-mobility group protein B2 (HMGB2) Literature-reported Target Target Info [17]
Runt-related transcription factor 2 (RUNX2) Literature-reported Target Target Info [18]
Protein(s) Regulated by This miRNA cAMP-dependent protein kinase catalytic subunit beta Regulated Protein [19]
Cyclin-G1 Regulated Protein [20]
Homeobox protein TGIF1 Regulated Protein [21]
Proline-rich acidic protein 1 Regulated Protein [4]
Ras GTPase-activating protein-binding protein 2 Regulated Protein [23]
Ras-related protein R-Ras2 Regulated Protein [24]
Regulator of G-protein signaling 5 Regulated Protein [25]
TGF-beta-activated kinase 1 and MAP3K7-binding protein 2 Regulated Protein [14]
TGF-beta-activated kinase 1 and MAP3K7-binding protein 3 Regulated Protein [14]
Thioredoxin-dependent peroxide reductase, mitochondrial Regulated Protein [27]
Transmembrane protein 64 Regulated Protein [28]
Ubiquitin-like protein ATG12 Regulated Protein [29]
Versican core protein Regulated Protein [30]
Zinc finger E-box-binding homeobox 1 Regulated Protein [31]
References
REF 1 Carbonic anhydrase activation is associated with worsened pathological remodeling in human ischemic diabetic cardiomyopathy. J Am Heart Assoc. 2014 Mar 26;3(2):e000434.
REF 2 miR-23b represses proto-oncogene Src kinase and functions as methylation-silenced tumor suppressor with diagnostic and prognostic significance in prostate cancer. Cancer Res. 2012 Dec 15;72(24):6435-46.
REF 3 Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem. 2008 Nov 28;283(48):33394-405.
REF 4 MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells. FEBS J. 2009 Jun;276(11):2966-82.
REF 5 miR-23b-3p induces the cellular metabolic memory of high glucose in diabetic retinopathy through a SIRT1-dependent signalling pathway. Diabetologia. 2016 Mar;59(3):644-54.
REF 6 Identification of miR-200a as a novel suppressor of connexin 43 in breast cancer cells. Biosci Rep. 2015 Aug 17;35(5). pii: e00251.
REF 7 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 8 The reciprocal regulation loop of Notch2 pathway and miR-23b in controlling gastric carcinogenesis. Oncotarget. 2015 Jul 20;6(20):18012-26.
REF 9 Role of microRNA-23b in flow-regulation of Rb phosphorylation and endothelial cell growth. Proc Natl Acad Sci U S A. 2010 Feb 16;107(7):3234-9.
REF 10 Exosomes from bone marrow mesenchymal stem cells contain a microRNA that promotes dormancy in metastatic breast cancer cells. Sci Signal. 2014 Jul 1;7(332):ra63.
REF 11 VHL regulates the effects of miR-23b on glioma survival and invasion via suppression of HIF-1/VEGF and -catenin/Tcf-4 signaling. Neuro Oncol. 2012 Aug;14(8):1026-36.
REF 12 Adipocyte-derived exosomal miRNAs: a novel mechanism for obesity-related disease. Pediatr Res. 2015 Mar;77(3):447-54.
REF 13 miRNA expression profiling in migrating glioblastoma cells: regulation of cell migration and invasion by miR-23b via targeting of Pyk2. PLoS One. 2012;7(6):e39818.
REF 14 The microRNA miR-23b suppresses IL-17-associated autoimmune inflammation by targeting TAB2, TAB3 and IKK-. Nat Med. 2012 Jul;18(7):1077-86.
REF 15 Inhibition of PTEN gene expression by oncogenic miR-23b-3p in renal cancer. PLoS One. 2012;7(11):e50203.
REF 16 Mir-23b and miR-130b expression is downregulated in pituitary adenomas. Mol Cell Endocrinol. 2014 Jun 5;390(1-2):1-7.
REF 17 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 18 MicroRNA-23b is an independent prognostic marker and suppresses ovarian cancer progression by targeting runt-related transcription factor-2. FEBS Lett. 2014 May 2;588(9):1608-15.
REF 19 The role of microRNA-23b in the differentiation of MSC into chondrocyte by targeting protein kinase A signaling.Biomaterials. 2012 Jun;33(18):4500-7.
REF 20 MiR-23b targets cyclin G1 and suppresses ovarian cancer tumorigenesis and progression.J Exp Clin Cancer Res. 2016 Feb 13;35:31.
REF 21 MicroRNA-23b-3p regulates human keratinocyte differentiation through repression of TGIF1 and activation of the TGF- SMAD2 signalling pathway.Exp Dermatol. 2017 Jan;26(1):51-57.
REF 22 MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells. FEBS J. 2009 Jun;276(11):2966-82.
REF 23 MicroRNA-23b Targets Ras GTPase-Activating Protein SH3 Domain-Binding Protein 2 to Alleviate Fibrosis and Albuminuria in Diabetic Nephropathy.J Am Soc Nephrol. 2016 Sep;27(9):2597-608.
REF 24 UVA and UVB irradiation differentially regulate microRNA expression in human primary keratinocytes.PLoS One. 2013 Dec 31;8(12):e83392.
REF 25 MicroRNAs that target RGS5.Iran J Basic Med Sci. 2015 Feb;18(2):108-14.
REF 26 The microRNA miR-23b suppresses IL-17-associated autoimmune inflammation by targeting TAB2, TAB3 and IKK-. Nat Med. 2012 Jul;18(7):1077-86.
REF 27 MicroRNA-26a-5p and microRNA-23b-3p up-regulate peroxiredoxin III in acute myeloid leukemia.Leuk Lymphoma. 2015 Feb;56(2):460-71.
REF 28 miR-23a/b regulates the balance between osteoblast and adipocyte differentiation in bone marrow mesenchymal stem cells.Bone Res. 2016 Aug 24;4:16022.
REF 29 miR-23b-3p regulates the chemoresistance of gastric cancer cells by targeting ATG12 and HMGB2. Cell Death Dis. 2015 May 21;6:e1766.
REF 30 Interleukin-17A promotes tongue squamous cell carcinoma metastasis through activating miR-23b/versican pathway.Oncotarget. 2017 Jan 24;8(4):6663-6680.
REF 31 MicroRNA-23b functions as a tumor suppressor by regulating Zeb1 in bladder cancer.PLoS One. 2013 Jul 2;8(7):e67686.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.