miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-30b-5p
miRNA Stemloop AC MI0000441
miRNA Stemloop ID hsa-mir-30b
Sequence uguaaacauccuacacucagcu
TTD Target(s) Regulated by This miRNA Platelet-derived growth factor receptor beta (PDGFRB) Successful Target Target Info [1]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [2]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [3]
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Clinical trial Target Target Info [4]
Endothelial plasminogen activator inhibitor (SERPINE1) Clinical trial Target Target Info [5]
Catalase (CAT) Clinical trial Target Target Info [6]
Notch-1 receptor (NOTCH1) Clinical trial Target Target Info [3]
Delta-like protein 4 (DLL4) Clinical trial Target Target Info [7]
Beclin-1 (BECN1) Literature-reported Target Target Info [8]
Eukaryotic initiation factor 5A2 (EIF5A2) Literature-reported Target Target Info [9]
Muscleblind-like protein 1 (MBNL2) Literature-reported Target Target Info [10]
G1/S-specific cyclin-E2 (CCNE2) Literature-reported Target Target Info [11]
Runt-related transcription factor 2 (RUNX2) Literature-reported Target Target Info [12]
Suppressor of cytokine signaling 1 (SOCS1) Literature-reported Target Target Info [13]
Protein(s) Regulated by This miRNA B-cell CLL/lymphoma 9 protein Regulated Protein
BCL9_HUMAN
[14]
B-cell lymphoma 6 protein Regulated Protein
BCL6_HUMAN
[13]
Collagen triple helix repeat-containing protein 1 Regulated Protein
CTHR1_HUMAN
[16]
Eukaryotic translation initiation factor 2 subunit 1 Regulated Protein
IF2A_HUMAN
[17]
Homeobox protein Hox-A1 Regulated Protein
HXA1_HUMAN
[18]
Homeobox protein SIX1 Regulated Protein
SIX1_HUMAN
[19]
Muscleblind-like protein 1 Regulated Protein
MBNL1_HUMAN
[10]
Muscleblind-like protein 3 Regulated Protein
MBNL3_HUMAN
[10]
Ras GTPase-activating protein nGAP Regulated Protein
NGAP_HUMAN
[21]
Transcriptional regulator ERG Regulated Protein
ERG_HUMAN
[22]
Ubiquitin-like protein ATG12 Regulated Protein
ATG12_HUMAN
[23]
Zinc finger protein SNAI1 Regulated Protein
SNAI1_HUMAN
[24]
References
REF 1 Alteration of circulating miRNAs in SSc: miR-30b regulates the expression of PDGF receptor . Rheumatology (Oxford). 2013 Nov;52(11):1963-72.
REF 2 NF-B-mediated miR-30b regulation in cardiomyocytes cell death by targeting Bcl-2. Mol Cell Biochem. 2014 Feb;387(1-2):135-41.
REF 3 Downregulation of microRNA-30 facilitates podocyte injury and is prevented by glucocorticoids. J Am Soc Nephrol. 2014 Jan;25(1):92-104.
REF 4 Decreased miR-30b-5p expression by DNMT1 methylation regulation involved in gastric cancer metastasis. Mol Biol Rep. 2014 Sep;41(9):5693-700.
REF 5 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response.Genes Dev. 2011 Oct 15;25(20):2173-86.
REF 6 MicroRNA-30b-mediated regulation of catalase expression in human ARPE-19 cells. PLoS One. 2012;7(8):e42542.
REF 7 The microRNA-30 family targets DLL4 to modulate endothelial cell behavior during angiogenesis. Blood. 2012 Dec 13;120(25):5063-72.
REF 8 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 9 MiR-30b suppresses tumor migration and invasion by targeting EIF5A2 in gastric cancer. World J Gastroenterol. 2015 Aug 21;21(31):9337-47.
REF 10 miR-30-5p Regulates Muscle Differentiation and Alternative Splicing of Muscle-Related Genes by Targeting MBNL. Int J Mol Sci. 2016 Jan 29;17(2). pii: E182.
REF 11 Trastuzumab produces therapeutic actions by upregulating miR-26a and miR-30b in breast cancer cells. PLoS One. 2012;7(2):e31422.
REF 12 Bone morphogenetic protein-2 decreases microRNA-30b and microRNA-30c to promote vascular smooth muscle cell calcification. J Am Heart Assoc. 2012 Dec;1(6):e003905.
REF 13 Downregulation of inflammatory microRNAs by Ig-like transcript 3 is essential for the differentiation of human CD8(+) T suppressor cells. J Immunol. 2012 Apr 1;188(7):3042-52.
REF 14 miR-30-5p functions as a tumor suppressor and novel therapeutic tool by targeting the oncogenic Wnt/-catenin/BCL9 pathway.Cancer Res. 2014 Mar 15;74(6):1801-13.
REF 15 Downregulation of inflammatory microRNAs by Ig-like transcript 3 is essential for the differentiation of human CD8(+) T suppressor cells. J Immunol. 2012 Apr 1;188(7):3042-52.
REF 16 microRNA-30b inhibits cell invasion and migration through targeting collagen triple helix repeat containing 1 in non-small cell lung cancer.Cancer Cell Int. 2015 Sep 17;15:85.
REF 17 A microRNA-mediated decrease in eukaryotic initiation factor 2 promotes cell survival during PS-341 treatment.Sci Rep. 2016 Feb 22;6:21565.
REF 18 miR-30b inhibits cancer cell growth, migration, and invasion by targeting homeobox A1 in esophageal cancer.Biochem Biophys Res Commun. 2017 Apr 1;485(2):506-512.
REF 19 miR-30b regulates migration and invasion of human colorectal cancer via SIX1.Biochem J. 2014 May 15;460(1):117-25.
REF 20 miR-30-5p Regulates Muscle Differentiation and Alternative Splicing of Muscle-Related Genes by Targeting MBNL. Int J Mol Sci. 2016 Jan 29;17(2). pii: E182.
REF 21 Temporal analysis of reciprocal miRNA-mRNA expression patterns predicts regulatory networks during differentiation in human skeletal muscle cells.Physiol Genomics. 2015 Mar;47(3):45-57.
REF 22 miR-30 as a tumor suppressor connects EGF/Src signal to ERG and EMT.Oncogene. 2014 May 8;33(19):2495-503.
REF 23 Compromised autophagy by MIR30B benefits the intracellular survival of Helicobacter pylori. Autophagy. 2012 Jul 1;8(7):1045-57.
REF 24 MicroRNA-30a inhibits epithelial-to-mesenchymal transition by targeting Snai1 and is downregulated in non-small cell lung cancer.Int J Cancer. 2012 May 1;130(9):2044-53.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.