miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-323a-3p | ||||
| miRNA Stemloop AC | MI0000807 | ||||
| miRNA Stemloop ID | hsa-mir-323a | ||||
| Sequence | cacauuacacggucgaccucu | ||||
| TTD Target(s) Regulated by This miRNA | Signal transducer and activator of transcription 3 (STAT3) | Successful Target | Target Info | [1] | |
| Mothers against decapentaplegic homolog 3 (SMAD3) | Successful Target | Target Info | [2] | ||
| CDK inhibitor 1B p27Kip1 (CDKN1B) | Literature-reported Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | Mothers against decapentaplegic homolog 2 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | Increased microRNA-323-3p in IL-22/IL-17-producing T cells and asthma: a role in the regulation of the TGF- pathway and IL-22 production. Allergy. 2017 Jan;72(1):55-65. | ||||
| REF 2 | MicroRNA-323-3p inhibits cell invasion and metastasis in pancreatic ductal adenocarcinoma via direct suppression of SMAD2 and SMAD3. Oncotarget. 2016 Mar 22;7(12):14912-24. | ||||
| REF 3 | MicroRNA-323-3p inhibits cell invasion and metastasis in pancreatic ductal adenocarcinoma via direct suppression of SMAD2 and SMAD3. Oncotarget. 2016 Mar 22;7(12):14912-24. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.