miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-548d-3p | ||||
miRNA Stemloop AC | MI0003668 | MI0003671 | ||||
miRNA Stemloop ID | hsa-mir-548d-1 | hsa-mir-548d-2 | ||||
Sequence | caaaaaccacaguuucuuuugc | ||||
TTD Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Successful Target | Target Info | [1] | |
Protein(s) Regulated by This miRNA | Apoptosis-stimulating of p53 protein 2 | Regulated Protein | [2] | ||
References | |||||
REF 1 | Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b. J Biol Chem. 2007 Jan 12;282(2):1479-86. | ||||
REF 2 | miR-548d-3p/TP53BP2 axis regulates the proliferation andpoptosis of breast cancer cells.Cancer Med. 2016 Feb;5(2):315-24. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.