miRNA General Information
miRNA Mature ID hsa-miR-548d-3p
miRNA Stemloop AC MI0003668 | MI0003671
miRNA Stemloop ID hsa-mir-548d-1 | hsa-mir-548d-2
Sequence caaaaaccacaguuucuuuugc
TTD Target(s) Regulated by This miRNA Erbb2 tyrosine kinase receptor (HER2) Successful Target Target Info [1]
Protein(s) Regulated by This miRNA Apoptosis-stimulating of p53 protein 2 Regulated Protein [2]
References
REF 1 Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b. J Biol Chem. 2007 Jan 12;282(2):1479-86.
REF 2 miR-548d-3p/TP53BP2 axis regulates the proliferation andpoptosis of breast cancer cells.Cancer Med. 2016 Feb;5(2):315-24.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.