miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-548p | ||||
| miRNA Stemloop AC | MI0006420 | ||||
| miRNA Stemloop ID | hsa-mir-548p | ||||
| Sequence | uagcaaaaacugcaguuacuuu | ||||
| TTD Target(s) Regulated by This miRNA | Apolipoprotein B-100 (APOB) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Ragulator complex protein LAMTOR5 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | Human MicroRNA-548p Decreases Hepatic Apolipoprotein B Secretion and Lipid Synthesis. Arterioscler Thromb Vasc Biol. 2017 May;37(5):786-793. | ||||
| REF 2 | miRNA-548p suppresses hepatitis B virus X protein associated hepatocellular carcinoma by downregulating oncoprotein hepatitis B x-interacting protein.Hepatol Res. 2016 Jul;46(8):804-15. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.