Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T01575 Target Info
Target Name Sphingosine-1-phosphate lyase 1 (SGPL1)
Synonyms hSPL; Sphingosine-1-phosphate aldolase; SPL 1; SP-lyase 1; S1PL; KIAA1252
Target Type Clinical trial Target
Gene Name SGPL1
Biochemical Class Carbon-carbon lyase
UniProt ID
O95470
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-125b-1-3p miRNA Info
miRNA Mature AC
MIMAT0004592
Sequence acggguuaggcucuugggagcu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-125b significantly reduced SGPL1 expression. [1]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
ERK activator kinase 7 (MAP2K7) Target Info
MP2K7_HUMAN
References  Top
REF 1 miR-125b Enhances IL-8 Production in Early-Onset Severe Preeclampsia by Targeting Sphingosine-1-Phosphate Lyase 1. PLoS One. 2016 Dec 9;11(12):e0166940.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.