Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T04386 Target Info
Target Name Annexin A2 (ANXA2)
Synonyms p36; Protein I; Placental anticoagulant protein IV; PAP-IV; Lipocortin II; LPC2D; Chromobindin-8; Calpactin-1 heavy chain; Calpactin I heavy chain; CAL1H; Annexin-2; Annexin II; ANX2L4; ANX2
Target Type Literature-reported Target
Gene Name ANXA2
Biochemical Class Annexin protein
UniProt ID
P07355
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-155 modulated brainn endothelial barrier function by targeting annexin-2. [2]
Evidence Score (E-score) 2 +
1 Immunocytochemistry; Immunohistochemistry; In Situ Hybridization; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [1]
2 Proteomics [2]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
MIMAT0000462
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-206 inhibits endogenous mRNA expression of ANXA2 gene in PANC-1 and PANC10.05 cells as well as total ANXA2 protein levels. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Immunohistochemistry; Western Blot [3]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
ANXA2_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 MicroRNA-155 negatively affects blood-brain barrier function during neuroinflammation. FASEB J. 2014 Jun;28(6):2551-65.
REF 2 Widespread changes in protein synthesis induced by microRNAs.Nature. 2008 Sep 4;455(7209):58-63.
REF 3 MicroRNA-206 functions as a pleiotropic modulator of cell proliferation, invasion and lymphangiogenesis in pancreatic adenocarcinoma by targeting ANXA2 and KRAS genes. Oncogene. 2015 Sep 10;34(37):4867-78.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.