miRNA General Information
miRNA Mature ID	hsa-miR-155-5p
miRNA Stemloop AC	MI0000681
miRNA Stemloop ID	hsa-mir-155
Sequence	uuaaugcuaaucgugauaggggu
miRNA General Information
miRNA Mature ID	hsa-miR-155-5p
miRNA Stemloop AC	MI0000681
miRNA Stemloop ID	hsa-mir-155
Sequence	uuaaugcuaaucgugauagggguu
TTD Target(s) Regulated by This miRNA	Angiotensin II receptor type-1 (AGTR1)	Successful Target	Target Info	[1]
	Interleukin-8 (IL8)	Successful Target	Target Info	[2]
	Intercellular adhesion molecule ICAM-1 (ICAM1)	Successful Target	Target Info	[3]
	Interleukin-2 (IL2)	Successful Target	Target Info	[4]
	Thyroid hormone receptor beta (THRB)	Successful Target	Target Info	[5]
	Mothers against decapentaplegic homolog 3 (SMAD3)	Successful Target	Target Info	[6]
	Vascular endothelial growth factor receptor 1 (FLT-1)	Successful Target	Target Info	[7]
	Nitric-oxide synthase endothelial (NOS3)	Clinical trial Target	Target Info	[8]
	Stress-activated protein kinase 2a (p38 alpha)	Clinical trial Target	Target Info	[9]
	Wee1-like protein kinase (WEE1)	Clinical trial Target	Target Info	[10]
	Caspase-3 (CASP3)	Clinical trial Target	Target Info	[11]
	SH2 domain inositol 5'-phosphatase 1 (INPP5D)	Clinical trial Target	Target Info	[12]
	E-selectin (SELE)	Clinical trial Target	Target Info	[3]
	G1/S-specific cyclin-D1 (CCND1)	Clinical trial Target	Target Info	[13]
	Myosin light kinase (MYLK)	Clinical trial Target	Target Info	[10]
	T-cell-specific kinase (ITK)	Clinical trial Target	Target Info	[4]
	DNA-binding factor KBF1 (p105)	Clinical trial Target	Target Info	[2]
	Hypoxia-inducible factor 1 alpha (HIF-1A)	Clinical trial Target	Target Info	[14]
	Keratinocyte growth factor (FGF7)	Clinical trial Target	Target Info	[15]
	Colony stimulating factor-1 receptor (CSF-1R)	Clinical trial Target	Target Info	[10]
	Signal transducer and activator of transcription 1 (STAT1)	Patented-recorded Target	Target Info	[16]
	Myeloid differentiation primary response protein MyD88 (MYD88)	Literature-reported Target	Target Info	[17]
	Transcription regulator protein BACH1 (Bach1)	Clinical trial Target	Target Info	[18]
	von Hippel-Lindau disease tumor suppressor (VHL)	Patented-recorded Target	Target Info	[19]
	Transcription factor AP-1 (JUN)	Discontinued Target	Target Info	[20]
	Transforming protein RhoA (RHOA)	Discontinued Target	Target Info	[21]
	Lectin-like oxidized LDL receptor (OLR1)	Clinical trial Target	Target Info	[2]
	RNA-binding protein Musashi-2 (MSI2)	Discontinued Target	Target Info	[15]
	Mixed lineage kinase 2 (MAP3K10)	Literature-reported Target	Target Info	[10]
	cAMP-dependent protein kinase A type I (PRKAR1A)	Literature-reported Target	Target Info	[10]
	Oxysterols receptor LXR-alpha (NR1H3)	Patented-recorded Target	Target Info	[22]
	Phosphatase and tensin homolog (PTEN)	Literature-reported Target	Target Info	[23]
	Proto-oncogene c-Myc (MYC)	Literature-reported Target	Target Info	[24]
	Ras-related C3 botulinum toxin substrate 1 (RAC1)	Literature-reported Target	Target Info	[10]
	Casein kinase I alpha (CSNK1A1)	Clinical trial Target	Target Info	[15]
	Matrix metalloproteinase-16 (MMP-16)	Literature-reported Target	Target Info	[25]
	Mitotic growth and transcription activator (BAF190A)	Literature-reported Target	Target Info	[10]
	PAK-2 protein kinase (PAK2)	Literature-reported Target	Target Info	[10]
	Protein kinase N2 (PKN2)	Literature-reported Target	Target Info	[15]
	Serine/threonine-protein kinase NIK (MAP3K14)	Literature-reported Target	Target Info	[10]
	Annexin A2 (ANXA2)	Literature-reported Target	Target Info	[15]
	CCAAT/enhancer binding protein beta (CEBPB)	Literature-reported Target	Target Info	[26]
	DNA repair protein RAD51 homolog 1 (RAD51)	Clinical trial Target	Target Info	[27]
	Endothelin-1 (EDN1)	Literature-reported Target	Target Info	[28]
	Histidine ammonia-lyase (HAL)	Literature-reported Target	Target Info	[10]
	Interleukin 13 receptor alpha-1 (IL13RA1)	Literature-reported Target	Target Info	[29]
	Lysine-specific demethylase 3A (KDM3A)	Literature-reported Target	Target Info	[30]
	Protein C-ets-1 (ETS1)	Literature-reported Target	Target Info	[31]
	Proto-oncogene c-Fos (c-Fos)	Literature-reported Target	Target Info	[9]
	Vascular cell adhesion protein 1 (VCAM1)	Literature-reported Target	Target Info	[7]
	Acetyl-CoA transporter (SLC33A1)	Patented-recorded Target	Target Info	[10]
	Cysteine-rich angiogenic inducer 61 (CYR61)	Literature-reported Target	Target Info	[32]
	DNA mismatch repair protein Mlh1 (MLH1)	Literature-reported Target	Target Info	[33]
	DNA mismatch repair protein MSH2 (MSH2)	Literature-reported Target	Target Info	[33]
	F-box and WD-40 domain protein 7 (Fbxw7)	Literature-reported Target	Target Info	[34]
	Homeobox protein Nkx-3.1 (NKX3-1)	Literature-reported Target	Target Info	[10]
	Methyl cpg binding protein 2 (MECP2)	Clinical trial Target	Target Info	[35]
	Pleiotrophin (PTN)	Literature-reported Target	Target Info	[36]
	Polybromo-1 (PBRM1)	Literature-reported Target	Target Info	[15]
	Telomeric repeat-binding factor 1 (TERF1)	Literature-reported Target	Target Info	[37]
	Transcription factor E2F2 (E2F2)	Literature-reported Target	Target Info	[38]
	Runt-related transcription factor 2 (RUNX2)	Literature-reported Target	Target Info	[39]
	SSX2-interacting protein (SSX2IP)	Literature-reported Target	Target Info	[10]
	Suppressor of cytokine signaling 1 (SOCS1)	Literature-reported Target	Target Info	[40]
Suppressor of cytokine signaling 3 (SOCS3)	Literature-reported Target	Target Info	[41]
Inhibitor of nuclear factor kappa-B kinase (IKK)	Patented-recorded Target	Target Info	[42]
Protein(s) Regulated by This miRNA	14-3-3 protein zeta/delta	Regulated Protein	1433Z_HUMAN	[10]
	28S ribosomal protein S27, mitochondrial	Regulated Protein	RT27_HUMAN	[10]
	39S ribosomal protein L18, mitochondrial	Regulated Protein	RM18_HUMAN	[10]
	Actin-related protein 2	Regulated Protein	ARP2_HUMAN	[10]
	Actin-related protein 2/3 complex subunit 3	Regulated Protein	ARPC3_HUMAN	[10]
	Adenomatous polyposis coli protein	Regulated Protein	APC_HUMAN	[44]
	ADP-ribosylation factor-like protein 15	Regulated Protein	ARL15_HUMAN	[10]
	Anamorsin	Regulated Protein	CPIN1_HUMAN	[10]
	Anaphase-promoting complex subunit 16	Regulated Protein	APC16_HUMAN	[10]
	Apoptotic protease-activating factor 1	Regulated Protein	APAF_HUMAN	[10]
	Arfaptin-1	Regulated Protein	ARFP1_HUMAN	[10]
	Armadillo repeat-containing protein 2	Regulated Protein	ARMC2_HUMAN	[10]
	Asparagine--tRNA ligase, cytoplasmic	Regulated Protein	SYNC_HUMAN	[10]
	Astrocytic phosphoprotein PEA-15	Regulated Protein	PEA15_HUMAN	[36]
	AT-rich interactive domain-containing protein 2	Regulated Protein	ARID2_HUMAN	[26]
	B-cell lymphoma 6 protein	Regulated Protein	BCL6_HUMAN	[47]
	Calcium-binding protein 39	Regulated Protein	CAB39_HUMAN	[10]
	Calcium-regulated heat-stable protein 1	Regulated Protein	CHSP1_HUMAN	[10]
	cAMP-dependent protein kinase inhibitor alpha	Regulated Protein	IPKA_HUMAN	[48]
	Carbonyl reductase family member 4	Regulated Protein	CBR4_HUMAN	[10]
	Caspase recruitment domain-containing protein 11	Regulated Protein	CAR11_HUMAN	[10]
	Centrosomal protein of 41 kDa	Regulated Protein	CEP41_HUMAN	[10]
	Centrosomal protein of 83 kDa	Regulated Protein	CEP83_HUMAN	[10]
	Chromodomain-helicase-DNA-binding protein 9	Regulated Protein	CHD9_HUMAN	[10]
	Claudin-1	Regulated Protein	CLD1_HUMAN	[49]
	Clusterin-associated protein 1	Regulated Protein	CLUA1_HUMAN	[10]
	Coiled-coil domain-containing protein 82	Regulated Protein	CCD82_HUMAN	[10]
	Cytochrome b-c1 complex subunit Rieske, mitochondrial	Regulated Protein	UCRI_HUMAN	[50]
	Cytochrome P450 2U1	Regulated Protein	CP2U1_HUMAN	[10]
	Cytoskeleton-associated protein 5	Regulated Protein	CKAP5_HUMAN	[51]
	DCN1-like protein 2	Regulated Protein	DCNL2_HUMAN	[10]
	Dedicator of cytokinesis protein 1	Regulated Protein	DOCK1_HUMAN	[49]
	Deoxynucleoside triphosphate triphosphohydrolase SAMHD1	Regulated Protein	SAMH1_HUMAN	[52]
	DET1 homolog	Regulated Protein	DET1_HUMAN	[26]
	DNA helicase MCM8	Regulated Protein	MCM8_HUMAN	[10]
	DNA mismatch repair protein Msh6	Regulated Protein	MSH6_HUMAN	[33]
	DNA polymerase epsilon subunit 3	Regulated Protein	DPOE3_HUMAN	[10]
	E3 ubiquitin-protein ligase RNF123	Regulated Protein	RN123_HUMAN	[54]
	E3 ubiquitin-protein ligase TRIM32	Regulated Protein	TRI32_HUMAN	[55]
	Ethanolamine kinase 2	Regulated Protein	EKI2_HUMAN	[36]
	Exosome complex component RRP4	Regulated Protein	EXOS2_HUMAN	[10]
	FAS-associated death domain protein	Regulated Protein	FADD_HUMAN	[56]
	Forkhead box protein O3	Regulated Protein	FOXO3_HUMAN	[57]
	Friend leukemia integration 1 transcription factor	Regulated Protein	FLI1_HUMAN	[31]
	G1/S-specific cyclin-D2	Regulated Protein	CCND2_HUMAN	[59]
	Gamma-aminobutyric acid receptor-associated protein-like 1	Regulated Protein	GBRL1_HUMAN	[10]
	GC-rich sequence DNA-binding factor 2	Regulated Protein	GCFC2_HUMAN	[10]
	Germinal center-associated signaling and motility protein	Regulated Protein	GCSAM_HUMAN	[60]
	Glycine amidinotransferase, mitochondrial	Regulated Protein	GATM_HUMAN	[10]
	Glycine amidinotransferase, mitochondrial	Regulated Protein	GATM_HUMAN	[15]
	GTP-binding protein Rheb	Regulated Protein	RHEB_HUMAN	[10]
	Histone deacetylase complex subunit SAP30L	Regulated Protein	SP30L_HUMAN	[10]
	Histone-lysine N-methyltransferase NSD3	Regulated Protein	NSD3_HUMAN	[2]
	HMG box-containing protein 1	Regulated Protein	HBP1_HUMAN	[10]
	Homeobox and leucine zipper protein Homez	Regulated Protein	HOMEZ_HUMAN	[63]
	Homeobox protein cut-like 1	Regulated Protein	CUX1_HUMAN	[64]
	Homeobox protein Meis1	Regulated Protein	MEIS1_HUMAN	[31]
	Immunoglobulin J chain	Regulated Protein	IGJ_HUMAN	[10]
	InaD-like protein	Regulated Protein	INADL_HUMAN	[65]
	Integrator complex subunit 6	Regulated Protein	INT6_HUMAN	[10]
	Interferon gamma receptor 1	Regulated Protein	INGR1_HUMAN	[66]
	Interleukin-17 receptor B	Regulated Protein	I17RB_HUMAN	[10]
	Kelch repeat and BTB domain-containing protein 2	Regulated Protein	KBTB2_HUMAN	[10]
	Kelch-like protein 5	Regulated Protein	KLHL5_HUMAN	[10]
Leucine-rich repeat-containing protein 59	Regulated Protein	LRC59_HUMAN	[10]
Ligand of Numb protein X 2	Regulated Protein	LNX2_HUMAN	[10]
Ligand-dependent nuclear receptor corepressor-like protein	Regulated Protein	LCORL_HUMAN	[10]
Ligand-dependent nuclear receptor-interacting factor 1	Regulated Protein	LRIF1_HUMAN	[10]
Lysine-rich coiled-coil protein 1	Regulated Protein	KRCC1_HUMAN	[10]
Macrosialin	Regulated Protein	CD68_HUMAN	[2]
MAGUK p55 subfamily member 5	Regulated Protein	MPP5_HUMAN	[10]
Matrin-3	Regulated Protein	MATR3_HUMAN	[18]
Max-interacting protein 1	Regulated Protein	MXI1_HUMAN	[68]
Meiosis regulator and mRNA stability factor 1	Regulated Protein	MARF1_HUMAN	[10]
Microphthalmia-associated transcription factor	Regulated Protein	MITF_HUMAN	[69]
Mitochondrial import inner membrane translocase subunit TIM14	Regulated Protein	TIM14_HUMAN	[10]
Mitochondrial import receptor subunit TOM20 homolog	Regulated Protein	TOM20_HUMAN	[10]
Mitogen-activated protein kinase 13	Regulated Protein	MK13_HUMAN	[70]
MORC family CW-type zinc finger protein 3	Regulated Protein	MORC3_HUMAN	[10]
Mothers against decapentaplegic homolog 2	Regulated Protein	SMAD2_HUMAN	[6]
Mothers against decapentaplegic homolog 4	Regulated Protein	SMAD4_HUMAN	[6]
Mothers against decapentaplegic homolog 5	Regulated Protein	SMAD5_HUMAN	[26]
Muscleblind-like protein 3	Regulated Protein	MBNL3_HUMAN	[10]
Myb-related protein A	Regulated Protein	MYBA_HUMAN	[10]
Myocyte-specific enhancer factor 2A	Regulated Protein	MEF2A_HUMAN	[10]
Neuronal membrane glycoprotein M6-b	Regulated Protein	GPM6B_HUMAN	[72]
NFATC2-interacting protein	Regulated Protein	NF2IP_HUMAN	[18]
Pachytene checkpoint protein 2 homolog	Regulated Protein	PCH2_HUMAN	[10]
Paladin	Regulated Protein	PALD_HUMAN	[10]
PC4 and SFRS1-interacting protein	Regulated Protein	PSIP1_HUMAN	[73]
PDZ and LIM domain protein 5	Regulated Protein	PDLI5_HUMAN	[10]
Periplakin	Regulated Protein	PEPL_HUMAN	[36]
PHD finger protein 14	Regulated Protein	PHF14_HUMAN	[10]
Phosphatidylinositide phosphatase SAC2	Regulated Protein	SAC2_HUMAN	[10]
Phosphatidylinositol 3-kinase regulatory subunit alpha	Regulated Protein	P85A_HUMAN	[74]
Phosphatidylinositol-binding clathrin assembly protein	Regulated Protein	PICAL_HUMAN	[10]
Plastin-1	Regulated Protein	PLSI_HUMAN	[10]
Polyhomeotic-like protein 2	Regulated Protein	PHC2_HUMAN	[10]
PRA1 family protein 3	Regulated Protein	PRAF3_HUMAN	[10]
Pre-mRNA-processing factor 17	Regulated Protein	PRP17_HUMAN	[10]
Probable ATP-dependent RNA helicase DHX40	Regulated Protein	DHX40_HUMAN	[10]
Probable E3 ubiquitin-protein ligase HERC4	Regulated Protein	HERC4_HUMAN	[10]
Protein argonaute-4	Regulated Protein	AGO4_HUMAN	[10]
Protein FAM135A	Regulated Protein	F135A_HUMAN	[31]
Protein FAM177A1	Regulated Protein	F177A_HUMAN	[10]
Protein FAM199X	Regulated Protein	F199X_HUMAN	[10]
Protein FAM91A1	Regulated Protein	F91A1_HUMAN	[10]
Protein Jade-1	Regulated Protein	JADE1_HUMAN	[18]
Protein Jumonji	Regulated Protein	JARD2_HUMAN	[38]
Protein KIBRA	Regulated Protein	KIBRA_HUMAN	[10]
Protein LDOC1	Regulated Protein	LDOC1_HUMAN	[18]
Protein lin-7 homolog C	Regulated Protein	LIN7C_HUMAN	[10]
Protein sel-1 homolog 1	Regulated Protein	SE1L1_HUMAN	[76]
Protocadherin-9	Regulated Protein	PCDH9_HUMAN	[10]
Rab11 family-interacting protein 2	Regulated Protein	RFIP2_HUMAN	[10]
Rap guanine nucleotide exchange factor 2	Regulated Protein	RPGF2_HUMAN	[10]
RB-associated KRAB zinc finger protein	Regulated Protein	RBAK_HUMAN	[10]
Regulator of nonsense transcripts 2	Regulated Protein	RENT2_HUMAN	[10]
Regulatory-associated protein of mTOR	Regulated Protein	RPTOR_HUMAN	[77]
RNA-binding protein Nova-1	Regulated Protein	NOVA1_HUMAN	[10]
Selenocysteine insertion sequence-binding protein 2	Regulated Protein	SEBP2_HUMAN	[10]
Serine/threonine-protein kinase greatwall	Regulated Protein	GWL_HUMAN	[15]
Serine/threonine-protein kinase WNK1	Regulated Protein	WNK1_HUMAN	[36]
SH3 and multiple ankyrin repeat domains protein 2	Regulated Protein	SHAN2_HUMAN	[78]
SH3 and PX domain-containing protein 2A	Regulated Protein	SPD2A_HUMAN	[78]
Ski oncogene	Regulated Protein	SKI_HUMAN	[79]
Solute carrier family 35 member F2	Regulated Protein	S35F2_HUMAN	[10]
Suppressor of cytokine signaling 6	Regulated Protein	SOCS6_HUMAN	[23]
Suppressor of cytokine signaling 6	Regulated Protein	SOCS6_HUMAN	[81]
Syntenin-1	Regulated Protein	SDCB1_HUMAN	[10]
TAF5-like RNA polymerase II p300/CBP-associated factor-associated factor 65 kDa subunit 5L	Regulated Protein	TAF5L_HUMAN	[10]
TBC1 domain family member 14	Regulated Protein	TBC14_HUMAN	[10]
TBC1 domain family member 8B	Regulated Protein	TBC8B_HUMAN	[10]
Teashirt homolog 3	Regulated Protein	TSH3_HUMAN	[82]
Tetraspanin-14	Regulated Protein	TSN14_HUMAN	[10]
TGF-beta-activated kinase 1 and MAP3K7-binding protein 2	Regulated Protein	TAB2_HUMAN	[64]
Trafficking kinesin-binding protein 1	Regulated Protein	TRAK1_HUMAN	[10]
Transcription factor 12	Regulated Protein	HTF4_HUMAN	[10]
Transcription factor A, mitochondrial	Regulated Protein	TFAM_HUMAN	[83]
Transcription factor HIVEP2	Regulated Protein	ZEP2_HUMAN	[26]
Transcription factor MafB	Regulated Protein	MAFB_HUMAN	[78]
Transcription factor PU.1	Regulated Protein	SPI1_HUMAN	[84]
Transcription factor SOX-6	Regulated Protein	SOX6_HUMAN	[85]
Transcription termination factor 1	Regulated Protein	TTF1_HUMAN	[10]
Transducin-like enhancer protein 4	Regulated Protein	TLE4_HUMAN	[10]
Transforming growth factor beta regulator 1	Regulated Protein	TBRG1_HUMAN	[63]
Transmembrane 6 superfamily member 1	Regulated Protein	TM6S1_HUMAN	[18]
Tubulin-specific chaperone A	Regulated Protein	TBCA_HUMAN	[10]
Tumor protein p53-inducible nuclear protein 1	Regulated Protein	T53I1_HUMAN	[86]
Twinfilin-1	Regulated Protein	TWF1_HUMAN	[36]
Ubiquilin-1	Regulated Protein	UBQL1_HUMAN	[10]
Ubiquitin domain-containing protein 2	Regulated Protein	UBTD2_HUMAN	[10]
Uncharacterized protein C17orf80	Regulated Protein	CQ080_HUMAN	[10]
Uncharacterized protein C3orf18	Regulated Protein	CC018_HUMAN	[6]
Unconventional myosin-Id	Regulated Protein	MYO1D_HUMAN	[10]
Unconventional myosin-X	Regulated Protein	MYO10_HUMAN	[39]
UPF0505 protein C16orf62	Regulated Protein	CP062_HUMAN	[10]
Vacuolar protein sorting-associated protein 18 homolog	Regulated Protein	VPS18_HUMAN	[10]
Vesicle transport protein GOT1B	Regulated Protein	GOT1B_HUMAN	[10]
WW domain binding protein 1-like	Regulated Protein	WBP1L_HUMAN	[10]
Zinc finger protein 248	Regulated Protein	ZN248_HUMAN	[10]
Zinc finger protein 254	Regulated Protein	ZN254_HUMAN	[10]
Zinc finger protein 28	Regulated Protein	ZNF28_HUMAN	[10]
Zinc finger protein 431	Regulated Protein	ZN431_HUMAN	[36]
Zinc finger protein 493	Regulated Protein	ZN493_HUMAN	[10]
Zinc finger protein 561	Regulated Protein	ZN561_HUMAN	[10]
Zinc finger protein 611	Regulated Protein	ZN611_HUMAN	[10]
Zinc finger protein 652	Regulated Protein	ZN652_HUMAN	[26]
Zinc finger protein 714	Regulated Protein	ZN714_HUMAN	[36]
Zinc finger protein 83	Regulated Protein	ZNF83_HUMAN	[10]
Zinc finger protein ZIC 3	Regulated Protein	ZIC3_HUMAN	[26]
Zinc finger transcription factor Trps1	Regulated Protein	TRPS1_HUMAN	[36]
References
REF 1	MicroRNA-155 regulates human angiotensin II type 1 receptor expression in fibroblasts. J Biol Chem. 2006 Jul 7;281(27):18277-84.
REF 2	MicroRNA-155 silencing enhances inflammatory response and lipid uptake in oxidized low-density lipoprotein-stimulated human THP-1 macrophages. J Investig Med. 2010 Dec;58(8):961-7.
REF 3	Cutting edge: TNF-induced microRNAs regulate TNF-induced expression of E-selectin and intercellular adhesion molecule-1 on human endothelial cells: feedback control of inflammation. J Immunol. 2010 Jan 1;184(1):21-5.
REF 4	TGF- conditions intestinal T cells to express increased levels of miR-155, associated with down-regulation of IL-2 and itk mRNA. Mucosal Immunol. 2013 Jan;6(1):167-76.
REF 5	Epigenetic regulation of thyroid hormone receptor beta in renal cancer. PLoS One. 2014 May 21;9(5):e97624.
REF 6	MicroRNA-155 targets SMAD2 and modulates the response of macrophages to transforming growth factor-{beta}. J Biol Chem. 2010 Dec 31;285(53):41328-36.
REF 7	Endothelial enriched microRNAs regulate angiotensin II-induced endothelial inflammation and migration. Atherosclerosis. 2011 Apr;215(2):286-93.
REF 8	Essential role of microRNA-155 in regulating endothelium-dependent vasorelaxation by targeting endothelial nitric oxide synthase. Hypertension. 2012 Dec;60(6):1407-14.
REF 9	Dysregulation of miR-106a and miR-591 confers paclitaxel resistance to ovarian cancer. Br J Cancer. 2013 Jul 23;109(2):452-61.
REF 10	Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22.
REF 11	miR-155 targets Caspase-3 mRNA in activated macrophages. RNA Biol. 2016;13(1):43-58.
REF 12	Inositol phosphatase SHIP1 is a primary target of miR-155. Proc Natl Acad Sci U S A. 2009 Apr 28;106(17):7113-8.
REF 13	MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57.
REF 14	Identification of hypoxia-inducible factor-1 alpha as a novel target for miR-17-92 microRNA cluster. Cancer Res. 2008 Jul 15;68(14):5540-5.
REF 15	Widespread changes in protein synthesis induced by microRNAs.Nature. 2008 Sep 4;455(7209):58-63.
REF 16	The miR-124-p63 feedback loop modulates colorectal cancer growth. Oncotarget. 2017 Apr 25;8(17):29101-29115.
REF 17	Identification of MyD88 as a novel target of miR-155, involved in negative regulation of Helicobacter pylori-induced inflammation. FEBS Lett. 2010 Apr 16;584(8):1481-6.
REF 18	Kaposi's sarcoma-associated herpesvirus encodes an ortholog of miR-155. J Virol. 2007 Dec;81(23):12836-45.
REF 19	Upregulation of miRNA-155 promotes tumour angiogenesis by targeting VHL and is associated with poor prognosis and triple-negative breast cancer. Oncogene. 2014 Feb 6;33(6):679-89.
REF 20	MiR-155 negatively regulates c-Jun expression at the post-transcriptional level in human dermal fibroblasts in vitro: implications in UVA irradiation-induced photoaging. Cell Physiol Biochem. 2012;29(3-4):331-40.
REF 21	MicroRNA-155 is regulated by the transforming growth factor beta/Smad pathway and contributes to epithelial cell plasticity by targeting RhoA. Mol Cell Biol. 2008 Nov;28(22):6773-84.
REF 22	The role of microRNA-155/liver X receptor pathway in experimental and idiopathic pulmonary fibrosis. J Allergy Clin Immunol. 2017 Jun;139(6):1946-1956.
REF 23	MiR-21 and MiR-155 promote non-small cell lung cancer progression by downregulating SOCS1, SOCS6, and PTEN. Oncotarget. 2016 Dec 20;7(51):84508-84519.
REF 24	Downregulation of microRNA-155 accelerates cell growth and invasion by targeting c-myc in human gastric carcinoma cells. Oncol Rep. 2014 Sep;32(3):951-6.
REF 25	MiR-155 inhibits cell migration of human cardiomyocyte progenitor cells (hCMPCs) via targeting of MMP-16. J Cell Mol Med. 2012 Oct;16(10):2379-86.
REF 26	MicroRNA-155 is an Epstein-Barr virus-induced gene that modulates Epstein-Barr virus-regulated gene expression pathways. J Virol. 2008 Jun;82(11):5295-306.
REF 27	Protective role of miR-155 in breast cancer through RAD51 targeting impairs homologous recombination after irradiation. Proc Natl Acad Sci U S A. 2014 Mar 25;111(12):4536-41.
REF 28	Ethanol-induced expression of ET-1 and ET-BR in liver sinusoidal endothelial cells and human endothelial cells involves hypoxia-inducible factor-1alpha and microrNA-199. J Immunol. 2009 Oct 15;183(8):5232-43.
REF 29	The interleukin 13 (IL-13) pathway in human macrophages is modulated by microRNA-155 via direct targeting of interleukin 13 receptor alpha1 (IL13Ralpha1). J Biol Chem. 2011 Jan 21;286(3):1786-94.
REF 30	Upregulation of MiR-155 in nasopharyngeal carcinoma is partly driven by LMP1 and LMP2A and downregulates a negative prognostic marker JMJD1A. PLoS One. 2011 Apr 26;6(4):e19137.
REF 31	MicroRNA 155 modulates megakaryopoiesis at progenitor and precursor level by targeting Ets-1 and Meis1 transcription factors. Br J Haematol. 2008 Nov;143(4):570-80.
REF 32	Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
REF 33	Modulation of mismatch repair and genomic stability by miR-155. Proc Natl Acad Sci U S A. 2010 Apr 13;107(15):6982-7.
REF 34	Tumor-suppressive function of long noncoding RNA MALAT1 in glioma cells by suppressing miR-155 expression and activating FBXW7 function. Am J Cancer Res. 2016 Nov 1;6(11):2561-2574.
REF 35	Chromosome 21-derived microRNAs provide an etiological basis for aberrant protein expression in human Down syndrome brains. J Biol Chem. 2010 Jan 8;285(2):1529-43.
REF 36	MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 37	miR-155 drives telomere fragility in human breast cancer by targeting TRF1. Cancer Res. 2014 Aug 1;74(15):4145-56.
REF 38	Reticuloendotheliosis virus strain T induces miR-155, which targets JARID2 and promotes cell survival. J Virol. 2009 Dec;83(23):12009-17.
REF 39	MicroRNA miR-155 inhibits bone morphogenetic protein (BMP) signaling and BMP-mediated Epstein-Barr virus reactivation. J Virol. 2010 Jul;84(13):6318-27.
REF 40	MicroRNAs regulate critical genes associated with multiple myeloma pathogenesis. Proc Natl Acad Sci U S A. 2008 Sep 2;105(35):12885-90.
REF 41	Borna disease virus encoded phosphoprotein inhibits host innate immunity by regulating miR-155. Antiviral Res. 2013 Apr;98(1):66-75.
REF 42	Epstein-Barr virus-induced miR-155 attenuates NF-kappaB signaling and stabilizes latent virus persistence. J Virol. 2008 Nov;82(21):10436-43.
REF 43	Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22.
REF 44	A single anti-microRNA antisense oligodeoxyribonucleotide (AMO) targeting multiple microRNAs offers an improved approach for microRNA interference.Nucleic Acids Res. 2009 Feb;37(3):e24.
REF 45	MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 46	MicroRNA-155 is an Epstein-Barr virus-induced gene that modulates Epstein-Barr virus-regulated gene expression pathways. J Virol. 2008 Jun;82(11):5295-306.
REF 47	MicroRNA-155 promotes atherosclerosis by repressing Bcl6 in macrophages.J Clin Invest. 2012 Nov;122(11):4190-202.
REF 48	MicroRNA-155 is required for Mycobacterium bovis BCG-mediated apoptosis of macrophages.Mol Cell Biol. 2012 Jun;32(12):2239-53.
REF 49	MicroRNA-155 negatively affects blood-brain barrier function during neuroinflammation. FASEB J. 2014 Jun;28(6):2551-65.
REF 50	MicroRNA-155 prevents necrotic cell death in human cardiomyocyte progenitor cells via targeting RIP1.J Cell Mol Med. 2011 Jul;15(7):1474-82.
REF 51	Quantitative proteomics identify novel miR-155 target proteins.PLoS One. 2011;6(7):e22146.
REF 52	Sterile alpha motif and histidine/aspartic acid domain-containing protein 1 (SAMHD1)-facilitated HIV restriction in astrocytes is regulated by miRNA-181a.J Neuroinflammation. 2015 Apr 8;12:66.
REF 53	Modulation of mismatch repair and genomic stability by miR-155. Proc Natl Acad Sci U S A. 2010 Apr 13;107(15):6982-7.
REF 54	miR-221 and miR-155 regulate human dendritic cell development, apoptosis, and IL-12 production through targeting of p27kip1, KPC1, and SOCS-1. Blood. 2011 Apr 21;117(16):4293-303.
REF 55	Identification of putative pathogenic microRNA and its downstream targets in anaplastic lymphoma kinase-negative anaplastic large cell lymphoma. Hum Pathol. 2014 Oct;45(10):1995-2005.
REF 56	Deregulated miR-155 promotes Fas-mediated apoptosis in human intervertebral disc degeneration by targeting FADD and caspase-3.J Pathol. 2011 Oct;225(2):232-42.
REF 57	MicroRNA-155 regulates cell survival, growth, and chemosensitivity by targeting FOXO3a in breast cancer.J Biol Chem. 2010 Jun 4;285(23):17869-79.
REF 58	MicroRNA 155 modulates megakaryopoiesis at progenitor and precursor level by targeting Ets-1 and Meis1 transcription factors. Br J Haematol. 2008 Nov;143(4):570-80.
REF 59	Overexpression of miR-155 promotes the proliferation and invasion of oral squamous carcinoma cells by regulating BCL6/cyclin D2.Int J Mol Med. 2016 May;37(5):1274-80.
REF 60	miR-155 regulates HGAL expression and increases lymphoma cell motility.Blood. 2012 Jan 12;119(2):513-20.
REF 61	Widespread changes in protein synthesis induced by microRNAs.Nature. 2008 Sep 4;455(7209):58-63.
REF 62	MicroRNA-155 silencing enhances inflammatory response and lipid uptake in oxidized low-density lipoprotein-stimulated human THP-1 macrophages. J Investig Med. 2010 Dec;58(8):961-7.
REF 63	Inhibition of the miR-155 target NIAM phenocopies the growth promoting effect of miR-155 in B-cell lymphoma.Oncotarget. 2016 Jan 19;7(3):2391-400.
REF 64	MicroRNA-155 modulates the interleukin-1 signaling pathway in activated human monocyte-derived dendritic cells. Proc Natl Acad Sci U S A. 2009 Feb 24;106(8):2735-40.
REF 65	The microRNA miR-155 controls CD8(+) T cell responses by regulating interferon signaling.Nat Immunol. 2013 Jun;14(6):593-602.
REF 66	Micro-RNA-155 inhibits IFN-gamma signaling in CD4+ T cells.Eur J Immunol. 2010 Jan;40(1):225-31.
REF 67	Kaposi's sarcoma-associated herpesvirus encodes an ortholog of miR-155. J Virol. 2007 Dec;81(23):12836-45.
REF 68	MicroRNA-155 promotes glioma cell proliferation via the regulation of MXI1.PLoS One. 2013 Dec 23;8(12):e83055.
REF 69	Interferon--induced miR-155 inhibits osteoclast differentiation by targeting SOCS1 and MITF. FEBS Lett. 2012 Sep 21;586(19):3255-62.
REF 70	miR-155 Regulates Glioma Cells Invasion and Chemosensitivity by p38 Isforms In Vitro. J Cell Biochem. 2015 Jul;116(7):1213-21.
REF 71	MicroRNA-155 targets SMAD2 and modulates the response of macrophages to transforming growth factor-{beta}. J Biol Chem. 2010 Dec 31;285(53):41328-36.
REF 72	Marek's disease virus microRNA designated Mdv1-pre-miR-M4 targets both cellular and viral genes.Arch Virol. 2010 Nov;155(11):1823-37.
REF 73	A role for microRNA-155 modulation in the anti-HIV-1 effects of Toll-like receptor 3 stimulation in macrophages.PLoS Pathog. 2012 Sep;8(9):e1002937.
REF 74	Quantitative proteomics reveals that miR-155 regulates the PI3K-AKT pathway in diffuse large B-cell lymphoma.Am J Pathol. 2012 Jul;181(1):26-33.
REF 75	Reticuloendotheliosis virus strain T induces miR-155, which targets JARID2 and promotes cell survival. J Virol. 2009 Dec;83(23):12009-17.
REF 76	Putative tumor suppressor gene SEL1L was downregulated by aberrantly upregulated hsa-mir-155 in human pancreatic ductal adenocarcinoma.Mol Carcinog. 2014 Sep;53(9):711-21.
REF 77	RPTOR, a novel target of miR-155, elicits a fibrotic phenotype of cystic fibrosis lung epithelium by upregulating CTGF.RNA Biol. 2016 Sep;13(9):837-47.
REF 78	LNA-mediated anti-miR-155 silencing in low-grade B-cell lymphomas.Blood. 2012 Aug 23;120(8):1678-86.
REF 79	microRNA profiling in Epstein-Barr virus-associated B-cell lymphoma.Nucleic Acids Res. 2011 Mar;39(5):1880-93.
REF 80	MiR-21 and MiR-155 promote non-small cell lung cancer progression by downregulating SOCS1, SOCS6, and PTEN. Oncotarget. 2016 Dec 20;7(51):84508-84519.
REF 81	MiRNA-155 mediates TAM resistance by modulating SOCS6-STAT3 signalling pathway in breast cancer. Am J Transl Res. 2015 Oct 15;7(10):2115-26.
REF 82	Hodgkin lymphoma cell lines are characterized by a specific miRNA expression profile. Neoplasia. 2009 Feb;11(2):167-76.
REF 83	Chromosome 21-derived hsa-miR-155-5p regulates mitochondrial biogenesis by targeting Mitochondrial Transcription Factor A (TFAM).Biochim Biophys Acta. 2015 Jul;1852(7):1420-7.
REF 84	MicroRNA-155 modulates the pathogen binding ability of dendritic cells (DCs) by down-regulation of DC-specific intercellular adhesion molecule-3 grabbing non-integrin (DC-SIGN).J Biol Chem. 2009 Jun 12;284(24):16334-42.
REF 85	Aberrant expression of microRNA 155 may accelerate cell proliferation by targeting sex-determining region Y box 6 in hepatocellular carcinoma.Cancer. 2012 May 1;118(9):2431-42.
REF 86	Tumor protein 53-induced nuclear protein 1 expression is repressed by miR-155, and its restoration inhibits pancreatic tumor development.Proc Natl Acad Sci U S A. 2007 Oct 9;104(41):16170-5.
REF 87	MicroRNA miR-155 inhibits bone morphogenetic protein (BMP) signaling and BMP-mediated Epstein-Barr virus reactivation. J Virol. 2010 Jul;84(13):6318-27.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.