Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T06671 Target Info
Target Name Interleukin-18 (IL18)
Synonyms Interleukin-1 gamma; Interferon-gamma inducing factor; Interferon gamma-inducing factor; Iboctadekin; IL1F4; IL-18; IL-1 gamma; IGIF; IFN-gamma-inducing factor
Target Type Clinical trial Target
Gene Name IL18
Biochemical Class Cytokine: interleukin
UniProt ID
Q14116
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-346 miRNA Info
miRNA Mature AC
MIMAT0000773
Sequence ugucugcccgcaugccugccucu
miRNA Species Homo sapiens
Regulation Mechanism miR-346 indirectly regulated IL-18 release by indirectly inhibiting LPS-induced Brutons tyrosine kinase expression in LPS-activated RA FLS. [2]
Evidence Score (E-score) 2 +
1 qRT-PCR; Luciferase Reporter Assay; Western Blot; Northern Blot [1]
2 qRT-PCR; Luciferase Reporter Assay; Western Blot; Northern Blot [2]
Representative Target(s) Regulated by This miRNA Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
Interleukin-18 (IL18) Target Info
IL18_HUMAN
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism Reduced miR-130a is involved in ITP via targeting of IL18 expression. [3]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-197-3p miRNA Info
miRNA Mature AC
MIMAT0000227
Sequence uucaccaccuucuccacccagc
miRNA Species Homo sapiens
Regulation Mechanism The mRNA and protein expression levels of IL-18 were significantly downregulated in THP-1 cells transfected with miR-197 mimic compared with cells transfected with miR-C and blank-C, and these were significantly upregulated in cells transfected with miR-197 inhibitor compared with cells transfected with anti-miR-C and blank-C. [4]
Evidence Score (E-score) 1 +
1 Microarray [4]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
References  Top
REF 1 Bruton's tyrosine kinase is involved in miR-346-related regulation of IL-18 release by lipopolysaccharide-activated rheumatoid fibroblast-like synoviocytes. J Immunol. 2009 Apr 15;182(8):5088-97.
REF 2 A limited set of human MicroRNA is deregulated in follicular thyroid carcinoma. J Clin Endocrinol Metab. 2006 Sep;91(9):3584-91.
REF 3 Reduced MIR130A is involved in primary immune thrombocytopenia via targeting TGFB1 and IL18. Br J Haematol. 2014 Sep;166(5):767-73.
REF 4 miR-197 Expression in Peripheral Blood Mononuclear Cells from Hepatitis B Virus-Infected Patients. Gut Liver. 2013 May;7(3):335-42.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.