Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T08379 Target Info
Target Name Homeobox protein Hox-A5 (HOXA5)
Synonyms Homeobox protein HoxA5; Homeobox protein Hox1C; Homeobox protein Hox-1C; HOX1C
Target Type Literature-reported Target
Gene Name HOXA5
Biochemical Class Antp homeobox
UniProt ID
P20719
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-130a-3p resulted in the decreased protein level of target HOXA5. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot; Northern Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot; Northern Blot [2]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [2]
2 Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 Regulation of angiogenesis through a microRNA (miR-130a) that down-regulates antiangiogenic homeobox genes GAX and HOXA5. Blood. 2008 Feb 1;111(3):1217-26.
REF 2 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 3 TNF- is a novel target of miR-19a. Int J Oncol. 2011 Apr;38(4):1013-22.
REF 4 MicroRNA expression profiling and target genes study in congenital microtia. Int J Pediatr Otorhinolaryngol. 2013 Apr;77(4):483-7.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.