Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T08391 Target Info
Target Name Janus kinase 2 (JAK-2)
Synonyms Tyrosine-protein kinase JAK2
Target Type Successful Target
Gene Name JAK2
Biochemical Class Kinase
UniProt ID
O60674
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot [1]
2 RT-PCR [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-135a-5p miRNA Info
miRNA Mature AC
MIMAT0000428
Sequence uauggcuuuuuauuccuauguga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-135a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target JAK2. [4]
Evidence Score (E-score) 2 +
1 Western Blot [3]
2 Western Blot; Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Janus kinase 2 (JAK-2) Target Info
JAK2_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism JAK2 is a direct functional target of miR-204 in NSCLC and miR-204 inhibited the invasion and migration of NSCLC cells by targeting JAK2. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-216a-5p miRNA Info
miRNA Mature AC
MIMAT0000273
Sequence uaaucucagcuggcaacuguga
miRNA Species Homo sapiens
Regulation Mechanism miR-216a binds to the 3'UTR of JAK2. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
miRNA Mature ID hsa-miR-375-3p miRNA Info
miRNA Mature AC
MIMAT0000728
Sequence uuuguucguucggcucgcguga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-375-3p by mature miRNA precursor transfection resulted in the decreased protein level of target JAK2. [4]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Janus kinase 2 (JAK-2) Target Info
JAK2_HUMAN
Yes-associated protein 1 (YAP1) Target Info
YAP1_HUMAN
References  Top
REF 1 Expression analysis of microRNA-125 in patients with polycythemia vera and essential thrombocythemia and correlation with JAK2 allele burden and laboratory findings. Int J Lab Hematol. 2015 Oct;37(5):661-7.
REF 2 Down-regulation of miR-125a-3p in human gastric cancer and its clinicopathological significance. Int J Oncol. 2012 May;40(5):1477-82.
REF 3 MiR-135a targets JAK2 and inhibits gastric cancer cell proliferation. Cancer Biol Ther. 2012 Mar;13(5):281-8.
REF 4 Regulation of JAK2 by miR-135a: prognostic impact in classic Hodgkin lymphoma. Blood. 2009 Oct 1;114(14):2945-51.
REF 5 miR-204 suppresses non-small-cell lung carcinoma (NSCLC) invasion and migration by targeting JAK2. Genet Mol Res. 2016 May 20;15(2).
REF 6 miR-216a may inhibit pancreatic tumor growth by targeting JAK2. FEBS Lett. 2015 Aug 4;589(17):2224-32.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.