Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T09826 |
Target Info
|
| Target Name |
DNA topoisomerase I (TOP1) |
| Synonyms |
DNA topoisomerase I |
| Target Type |
Successful Target |
| Gene Name |
TOP1 |
| Biochemical Class |
Topoisomerase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-23a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aucacauugccagggauuucc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-23a can decrease luciferase activity of TOP1 3'UTR by sequence-specific base pairing with the 63844 3'UTR of TOP1. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
|
DNA topoisomerase I (TOP1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-23a-mediated inhibition of topoisomerase 1 expression potentiates cell response to etoposide in human hepatocellular carcinoma. Mol Cancer. 2013 Oct 8;12(1):119.
|
| REF 2 |
MiR-23a regulates DNA damage repair and apoptosis in UVB-irradiated HaCaT cells. J Dermatol Sci. 2013 Jan;69(1):68-76.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
