The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-379-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugguagacuauggaacguagg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-379-5p exerted this function by directly targeting focal adhesion kinase (FAK) 3'UTR and repressing FAK expression, thus leading to suppression of AKT signaling. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Immunohistochemical Staining |
[1] |
2 |
Immunohistochemistry; Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Focal adhesion kinase 1 (FAK)
|
Target Info
|
|
Interleukin-11 (IL11)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-193a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aacuggccuacaaagucccagu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-193a-3p by mature miRNA precursor transfection resulted in the decreased protein level of target PTK2. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
E2F transcription factor 1 (E2F1)
|
Target Info
|
|
Erbb2 tyrosine kinase receptor (HER2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-543 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aaacauucgcggugcacuucuu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
FAK is a direct target of miR-543. |
[4] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Focal adhesion kinase 1 (FAK)
|
Target Info
|
|
High mobility group protein HMGI-C (HMGA2)
|
Target Info
|
|