The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-122-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggagugugacaaugguguuug
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
2 |
Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
Apoptosis regulator Bcl-xL (BCL-xL)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-142-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uguaguguuuccuacuuuaugga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
IL1A 39-UTR is a bona fide target of this miR-142-3p. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
High mobility group protein B1 (HMGB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-191-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caacggaaucccaaaagcagcug
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[4] |
Representative Target(s) Regulated by This miRNA |
CCAAT/enhancer binding protein beta (CEBPB)
|
Target Info
|
|
Cyclin-dependent kinase 6 (CDK6)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-92a-1-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agguugggaucgguugcaaugcu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-92a downregulates mRNA expression of IL-1b. |
[5] |
Evidence Score (E-score) |
1 |
+ |
1 |
Microarray |
[5] |
Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|