Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T16739 Target Info
Target Name Lysine-specific histone demethylase 1 (LSD)
Synonyms Lysine-specific histone demethylase 1A; LSD1; KIAA0601; KDM1; Flavin-containing amine oxidase domain-containing protein 2; BRAF35-HDAC complex protein BHC110; AOF2
Target Type Clinical trial Target
Gene Name KDM1A
Biochemical Class CH-NH(2) donor oxidoreductase
UniProt ID
O60341
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-708-5p miRNA Info
miRNA Mature AC
MIMAT0004926
Sequence aaggagcuuacaaucuagcuggg
miRNA Species Homo sapiens
Regulation Mechanism miR-708 directly targets KDM1A 3'UTR to downregulate the expression. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 miR-708/LSD1 axis regulates the proliferation and invasion of breast cancer cells. Cancer Med. 2016 Apr;5(4):684-92.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.