miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-708-5p | ||||
| miRNA Stemloop AC | MI0005543 | ||||
| miRNA Stemloop ID | hsa-mir-708 | ||||
| Sequence | aaggagcuuacaaucuagcuggg | ||||
| TTD Target(s) Regulated by This miRNA | Matrix metalloproteinase-2 (MMP-2) | Successful Target | Target Info | [1] | |
| Poly [ADP-ribose] polymerase 1 (PARP1) | Successful Target | Target Info | [1] | ||
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [1] | ||
| Programmed cell death 1 ligand 1 (PD-L1) | Successful Target | Target Info | [2] | ||
| Mothers against decapentaplegic homolog 3 (SMAD3) | Successful Target | Target Info | [3] | ||
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [1] | ||
| Apoptosis inhibitor survivin (BIRC5) | Clinical trial Target | Target Info | [4] | ||
| Enhancer of zeste homolog 2 (EZH2) | Successful Target | Target Info | [1] | ||
| Lysine-specific histone demethylase 1 (LSD) | Clinical trial Target | Target Info | [5] | ||
| Ciliary neurotrophic factor receptor alpha (CNTFR) | Clinical trial Target | Target Info | [6] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [1] | ||
| Extracellular matrix receptor III (CD44) | Clinical trial Target | Target Info | [7] | ||
| Caspase-2 (CASP2) | Patented-recorded Target | Target Info | [8] | ||
| RAC-beta serine/threonine-protein kinase (AKT2) | Literature-reported Target | Target Info | [7] | ||
| Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [9] | ||
| Zinc finger E-box-binding homeobox 2 (ZEB2) | Literature-reported Target | Target Info | [10] | ||
| Protein(s) Regulated by This miRNA | Eyes absent homolog 3 | Regulated Protein | [11] | ||
| Neuronatin | Regulated Protein | [12] | |||
| NF-kappa-B essential modulator | Regulated Protein | [13] | |||
| Transmembrane protein 88 | Regulated Protein | [14] | |||
| References | |||||
| REF 1 | miR-708 acts as a tumor suppressor in human glioblastoma cells. Oncol Rep. 2013 Aug;30(2):870-6. | ||||
| REF 2 | Identifying microRNAs regulating B7-H3 in breast cancer: the clinical impact of microRNA-29c. Br J Cancer. 2014 Apr 15;110(8):2072-80. | ||||
| REF 3 | MiR-708 promotes steroid-induced osteonecrosis of femoral head, suppresses osteogenic differentiation by targeting SMAD3. Sci Rep. 2016 Mar 2;6:22599. | ||||
| REF 4 | MicroRNA-708 induces apoptosis and suppresses tumorigenicity in renal cancer cells. Cancer Res. 2011 Oct 1;71(19):6208-19. | ||||
| REF 5 | miR-708/LSD1 axis regulates the proliferation and invasion of breast cancer cells. Cancer Med. 2016 Apr;5(4):684-92. | ||||
| REF 6 | Overexpression of miR-708 and its targets in the childhood common precursor B-cell ALL. Pediatr Blood Cancer. 2013 Dec;60(12):2060-7. | ||||
| REF 7 | miRNA-708 control of CD44(+) prostate cancer-initiating cells. Cancer Res. 2012 Jul 15;72(14):3618-30. | ||||
| REF 8 | miR-708 promotes the development of bladder carcinoma via direct repression of Caspase-2. J Cancer Res Clin Oncol. 2013 Jul;139(7):1189-98. | ||||
| REF 9 | Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. Cancer Res. 2008 Nov 15;68(22):9125-30. | ||||
| REF 10 | The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol. 2008 May;10(5):593-601. | ||||
| REF 11 | EWS/FLI1 regulates EYA3 in Ewing sarcoma via modulation of miRNA-708, resulting in increased cell survival and chemoresistance.Mol Cancer Res. 2012 Aug;10(8):1098-108. | ||||
| REF 12 | Suppression of miRNA-708 by polycomb group promotes metastases by calcium-induced cell migration.Cancer Cell. 2013 Jan 14;23(1):63-76. | ||||
| REF 13 | MicroRNA mediation of endothelial inflammatory response to smooth muscle cells and its inhibition by atheroprotective shear stress. Circ Res. 2015 Mar 27;116(7):1157-69. | ||||
| REF 14 | Increased miR-708 expression in NSCLC and its association with poor survival in lung adenocarcinoma from never smokers.Clin Cancer Res. 2012 Jul 1;18(13):3658-67. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.