Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T18639 |
Target Info
|
| Target Name |
Heparin-binding growth factor 1 (FGF1) |
| Synonyms |
HBGF-1; Fibroblast growth factor 1; FGFA; FGF-1; Endothelial cell growth factor; ECGF-beta; ECGF; Beta-endothelial cell growth factor; Acidic fibroblast growth factor; AFGF |
| Target Type |
Clinical trial Target |
| Gene Name |
FGF1 |
| Biochemical Class |
Growth factor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-326 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ccucugggcccuuccuccag
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Overexpressed miR-326 inhibited FGF1 expression both in mRNA and protein levels. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunohistochemistry; Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-xL (BCL-xL)
|
Target Info
|
|
|
Fascin (FSCN1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Knockdown of long non-coding RNA HOTAIR inhibits malignant biological behaviors of human glioma cells via modulation of miR-326. Oncotarget. 2015 Sep 8;6(26):21934-49.
|
| REF 2 |
MiR-326 antagomir delays the progression of age-related cataract by upregulating FGF1-mediated expression of betaB2-crystallin. Biochem Biophys Res Commun. 2018 Oct 28;505(2):505-510.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
