Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T21334 |
Target Info
|
Target Name |
Osteoclast differentiation factor (ODF) |
Synonyms |
Tumor necrosis factor ligand superfamily member 11; TRANCE; TNF-related activation-induced cytokine; Receptor activatorof nuclear factor kappa B ligand; Receptor activator of nuclear factor kappa-B ligand; RANKL; Osteoprotegerin ligand; OPGL; CD254 |
Target Type |
Successful Target |
Gene Name |
TNFSF11 |
Biochemical Class |
Cytokine: tumor necrosis factor |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-106b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaagugcugacagugcagau
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-106b directly targets RANKL. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay; Northern Blot; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-18a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaggugcaucuagugcagauag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Northern Blot; Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
References |
Top |
REF 1 |
MicroRNA-106b inhibits osteoclastogenesis and osteolysis by targeting RANKL in giant cell tumor of bone. Oncotarget. 2015 Aug 7;6(22):18980-96.
|
REF 2 |
Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.