Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T21460 Target Info
Target Name Bcl-2-binding component 3 (BBC3)
Synonyms p53 upregulated modulator of apoptosis; p53 up-regulated modulator of apoptosis; PUMA; JFY1; JFY-1; Bcl2binding component 3
Target Type Literature-reported Target
Gene Name BBC3
Biochemical Class B-cell lymphoma Bcl-2
UniProt ID
Q9BXH1
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-221-3p resulted in the changed protein level of target BBC3. [2]
Evidence Score (E-score) 5 +
1 Immunoblot; In Situ Hybridization; Luciferase Reporter Assay; Microarray; qRT-PCR [1]
2 Immunoblot; In Situ Hybridization; Luciferase Reporter Assay; Microarray; qRT-PCR [2]
3 Luciferase Reporter Assay [3]
4 Luciferase Reporter Assay; Northern Blot; Western Blot [4]
5 Luciferase Reporter Assay; qRT-PCR; Western Blot; Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-222-3p resulted in the changed protein level of target BBC3. [2]
Evidence Score (E-score) 5 +
1 Immunoblot; In Situ Hybridization; Luciferase Reporter Assay; Microarray; qRT-PCR [1]
2 Immunoblot; In Situ Hybridization; Luciferase Reporter Assay; Microarray; qRT-PCR [2]
3 Immunofluorescence; Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
4 Luciferase Reporter Assay [3]
5 Luciferase Reporter Assay; Northern Blot; Western Blot [4]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-483-3p miRNA Info
miRNA Mature AC
MIMAT0002173
Sequence ucacuccucuccucccgucuu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot; Northern Blot [7]
2 Microarray; qRT-PCR; Western Blot [8]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-149-5p miRNA Info
miRNA Mature AC
MIMAT0000450
Sequence ucuggcuccgugucuucacuccc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot; Western Blot [9]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-296-5p miRNA Info
miRNA Mature AC
MIMAT0000690
Sequence agggcccccccucaauccugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-504-5p miRNA Info
miRNA Mature AC
MIMAT0002875
Sequence agacccuggucugcacucuauc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [11]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
References  Top
REF 1 Targeting the miR-221-222/PUMA/BAK/BAX Pathway Abrogates Dexamethasone Resistance in Multiple Myeloma. Cancer Res. 2015 Oct 15;75(20):4384-4397.
REF 2 miR-221 overexpression contributes to liver tumorigenesis. Proc Natl Acad Sci U S A. 2010 Jan 5;107(1):264-9.
REF 3 PUMA is a novel target of miR-221/222 in human epithelial cancers. Int J Oncol. 2010 Dec;37(6):1621-6.
REF 4 MiR-221 and miR-222 target PUMA to induce cell survival in glioblastoma. Mol Cancer. 2010 Sep 2;9:229.
REF 5 Downregulation of miR-221/222 sensitizes glioma cells to temozolomide by regulating apoptosis independently of p53 status. Oncol Rep. 2012 Mar;27(3):854-60.
REF 6 miR-222 regulates the cell biological behavior of oral squamous cell carcinoma by targeting PUMA. Oncol Rep. 2014 Mar;31(3):1255-62.
REF 7 Oncogenic role of miR-483-3p at the IGF2/483 locus. Cancer Res. 2010 Apr 15;70(8):3140-9.
REF 8 Over-expression of the miR-483-3p overcomes the miR-145/TP53 pro-apoptotic loop in hepatocellular carcinoma. Oncotarget. 2016 May 24;7(21):31361-71.
REF 9 A pre-microRNA-149 (miR-149) genetic variation affects miR-149 maturation and its ability to regulate the Puma protein in apoptosis. J Biol Chem. 2013 Sep 13;288(37):26865-77.
REF 10 A role for miR-296 in the regulation of lipoapoptosis by targeting PUMA. J Lipid Res. 2011 Aug;52(8):1517-25.
REF 11 Negative regulation of tumor suppressor p53 by microRNA miR-504. Mol Cell. 2010 Jun 11;38(5):689-99.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.