Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T22095 |
Target Info
|
Target Name |
Interleukin-17 (IL17) |
Synonyms |
Interleukin-17A; IL-17A; IL-17; Cytotoxic T-lymphocyte-associated antigen 8; Cytotoxic T lymphocyte-associated antigen 8; CTLA8; CTLA-8 |
Target Type |
Successful Target |
Gene Name |
IL17A |
Biochemical Class |
Cytokine: interleukin |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-155-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cuccuacauauuagcauuaaca
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
qRT-PCR |
[1] |
2 |
Western Blot; qRT-PCR; Immunofluorescence; Microscopy |
[2] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
Erbb2 tyrosine kinase receptor (HER2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-16-1-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ccaguauuaacugugcugcuga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
G1/S-specific cyclin-D1 (CCND1)
|
Target Info
|
|
References |
Top |
REF 1 |
MicroRNA-155 regulates host immune response to postviral bacterial pneumonia via IL-23/IL-17 pathway. Am J Physiol Lung Cell Mol Physiol. 2016 Mar 1;310(5):L465-75.
|
REF 2 |
Association of microRNA-155, interleukin 17A, and proteinuria in preeclampsia. Medicine (Baltimore). 2017 May;96(18):e6509.
|
REF 3 |
MiR-15a/16 regulates the growth of myeloma cells, angiogenesis and antitumor immunity by inhibiting Bcl-2, VEGF-A and IL-17 expression in multiple myeloma. Leuk Res. 2016 Oct;49:73-9.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.