Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T29960 Target Info
Target Name Wilms tumor protein (WT1)
Synonyms Wilms' tumour 1 protein; WT33; WT1 protein
Target Type Clinical trial Target
Gene Name WT1
Biochemical Class EGR C2H2-type zinc-finger
UniProt ID
P19544
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-15a-5p resulted in the decreased mRNA level of target WT1. [1]
Evidence Score (E-score) 2 +
1 qRT-PCR [1]
2 qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-16-5p miRNA Info
miRNA Mature AC
MIMAT0000069
Sequence uagcagcacguaaauauuggcg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-16-5p resulted in the decreased mRNA level of target WT1. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Corticotropin-releasing factor binding protein (CRHBP) Target Info
CRHBP_HUMAN
miRNA Mature ID hsa-miR-193a-5p miRNA Info
miRNA Mature AC
MIMAT0004614
Sequence ugggucuuugcgggcgagauga
miRNA Species Homo sapiens
Regulation Mechanism miR-193a reduced the expression of WT1, which negatively regulated the protein level of E-cadherin, suggesting that miR-193a might prevent EMT via modulating WT1-E-cadherin axis. And miR-193a has an ability to bind CDS of WT1. Thus, miR-193a modulates E-cadherin expression through targeting WT1. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Immunofluorescence; Western Blot [3]
Representative Target(s) Regulated by This miRNA AP-2 transcription factor (TFAP2A) Target Info
AP2A_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
References  Top
REF 1 MiR-15a and miR-16-1 cluster functions in human leukemia. Proc Natl Acad Sci U S A. 2008 Apr 1;105(13):5166-71.
REF 2 Pure curcumin decreases the expression of WT1 by upregulation of miR-15a and miR-16-1 in leukemic cells. J Exp Clin Cancer Res. 2012 Mar 27;31:27.
REF 3 Pathologically decreased expression of miR-193a contributes to metastasis by targeting WT1-E-cadherin axis in non-small cell lung cancers. J Exp Clin Cancer Res. 2016 Nov 7;35(1):173.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.