Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T40299 Target Info
Target Name Autophagy-related 2B (ATG2B)
Synonyms C14orf103; Autophagyrelated protein 2 homolog B; Autophagy-related protein 2 homolog B
Target Type Literature-reported Target
Gene Name ATG2B
Biochemical Class Autophagy phagophore-formation transporter
UniProt ID
Q96BY7
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism ATG2B is a direct target of miR-130a. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-30d-5p miRNA Info
miRNA Mature AC
MIMAT0000245
Sequence uguaaacauccccgacuggaag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Autophagy-related 2B (ATG2B) Target Info
ATG2B_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-1303 miRNA Info
miRNA Mature AC
MIMAT0005891
Sequence uuuagagacggggucuugcucu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-1303 significantly suppressed BCG-induced ATG2B protein production. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Autophagy-related 2B (ATG2B) Target Info
ATG2B_HUMAN
Claudin-18 (CLDN18) Target Info
CLD18_HUMAN
References  Top
REF 1 miRNA-130a targets ATG2B and DICER1 to inhibit autophagy and trigger killing of chronic lymphocytic leukemia cells. Cancer Res. 2012 Apr 1;72(7):1763-72.
REF 2 mir-30d Regulates multiple genes in the autophagy pathway and impairs autophagy process in human cancer cells. Biochem Biophys Res Commun. 2013 Feb 15;431(3):617-22.
REF 3 MiR-1303 Regulates Mycobacteria Induced Autophagy by Targeting Atg2B. PLoS One. 2016 Jan 15;11(1):e0146770.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.