miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-30d-5p | ||||
| miRNA Stemloop AC | MI0000255 | ||||
| miRNA Stemloop ID | hsa-mir-30d | ||||
| Sequence | uguaaacauccccgacuggaag | ||||
| TTD Target(s) Regulated by This miRNA | Caspase-3 (CASP3) | Clinical trial Target | Target Info | [1] | |
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [2] | ||
| Enhancer of zeste homolog 2 (EZH2) | Successful Target | Target Info | [3] | ||
| Notch-1 receptor (NOTCH1) | Clinical trial Target | Target Info | [4] | ||
| MEK kinase kinase 4 (MAP4K4) | Patented-recorded Target | Target Info | [5] | ||
| Importin beta (KPNB1) | Literature-reported Target | Target Info | [6] | ||
| Autophagy-related 2B (ATG2B) | Literature-reported Target | Target Info | [7] | ||
| Beclin-1 (BECN1) | Literature-reported Target | Target Info | [7] | ||
| Runt-related transcription factor 2 (RUNX2) | Literature-reported Target | Target Info | [8] | ||
| Suppressor of cytokine signaling 1 (SOCS1) | Literature-reported Target | Target Info | [9] | ||
| Protein(s) Regulated by This miRNA | Autophagy protein 5 | Regulated Protein | [7] | ||
| B-cell CLL/lymphoma 9 protein | Regulated Protein | [11] | |||
| BCL2/adenovirus E1B 19 kDa protein-interacting protein 3-like | Regulated Protein | [7] | |||
| G-protein coupled receptor 78 | Regulated Protein | [12] | |||
| Guanine nucleotide-binding protein G(i) subunit alpha-2 | Regulated Protein | [13] | |||
| LIM and senescent cell antigen-like-containing domain protein 1 | Regulated Protein | [5] | |||
| Phosphatidylinositol 3-kinase regulatory subunit beta | Regulated Protein | [15] | |||
| Protein phosphatase 1 regulatory subunit 14C | Regulated Protein | [5] | |||
| Ubiquitin-like protein ATG12 | Regulated Protein | [7] | |||
| Zinc finger protein SNAI1 | Regulated Protein | [16] | |||
| References | |||||
| REF 1 | A combined array-based comparative genomic hybridization and functional library screening approach identifies mir-30d as an oncomir in cancer. Cancer Res. 2012 Jan 1;72(1):154-64. | ||||
| REF 2 | Negative regulation of the tumor suppressor p53 gene by microRNAs. Oncogene. 2011 Feb 17;30(7):843-53. | ||||
| REF 3 | Down-regulation of the miR-25 and miR-30d contributes to the development of anaplastic thyroid carcinoma targeting the polycomb protein EZH2. J Clin Endocrinol Metab. 2012 May;97(5):E710-8. | ||||
| REF 4 | Downregulation of microRNA-30 facilitates podocyte injury and is prevented by glucocorticoids. J Am Soc Nephrol. 2014 Jan;25(1):92-104. | ||||
| REF 5 | Circulating MicroRNA-30d Is Associated With Response to Cardiac Resynchronization Therapy in Heart Failure and Regulates Cardiomyocyte Apoptosis: A Translational Pilot Study. Circulation. 2015 Jun 23;131(25):2202-2216. | ||||
| REF 6 | EZH2-miR-30d-KPNB1 pathway regulates malignant peripheral nerve sheath tumour cell survival and tumourigenesis. J Pathol. 2014 Feb;232(3):308-18. | ||||
| REF 7 | mir-30d Regulates multiple genes in the autophagy pathway and impairs autophagy process in human cancer cells. Biochem Biophys Res Commun. 2013 Feb 15;431(3):617-22. | ||||
| REF 8 | Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis. Genome Biol. 2011 Jul 18;12(7):R64. | ||||
| REF 9 | The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484. | ||||
| REF 10 | mir-30d Regulates multiple genes in the autophagy pathway and impairs autophagy process in human cancer cells. Biochem Biophys Res Commun. 2013 Feb 15;431(3):617-22. | ||||
| REF 11 | miR-30-5p functions as a tumor suppressor and novel therapeutic tool by targeting the oncogenic Wnt/-catenin/BCL9 pathway.Cancer Res. 2014 Mar 15;74(6):1801-13. | ||||
| REF 12 | miR-30d, miR-181a and miR-199a-5p cooperatively suppress the endoplasmic reticulum chaperone and signaling regulator GRP78 in cancer.Oncogene. 2013 Sep 26;32(39):4694-701. | ||||
| REF 13 | MicroRNA-30d promotes tumor invasion and metastasis by targeting Galphai2 in hepatocellular carcinoma.Hepatology. 2010 Mar;51(3):846-56. | ||||
| REF 14 | Circulating MicroRNA-30d Is Associated With Response to Cardiac Resynchronization Therapy in Heart Failure and Regulates Cardiomyocyte Apoptosis: A Translational Pilot Study. Circulation. 2015 Jun 23;131(25):2202-2216. | ||||
| REF 15 | Regulation of Insulin Resistance by Multiple MiRNAs via Targeting the GLUT4 Signalling Pathway. Cell Physiol Biochem. 2016;38(5):2063-78. | ||||
| REF 16 | MicroRNA-30a inhibits epithelial-to-mesenchymal transition by targeting Snai1 and is downregulated in non-small cell lung cancer.Int J Cancer. 2012 May 1;130(9):2044-53. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.