Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T42000 Target Info
Target Name Interleukin-1 beta (IL1B)
Synonyms IL1F2; IL-1beta; IL-1 beta; Catabolin
Target Type Successful Target
Gene Name IL1B
Biochemical Class Cytokine: interleukin
UniProt ID
P01584
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-887-3p miRNA Info
miRNA Mature AC
MIMAT0004951
Sequence gugaacgggcgccaucccgagg
miRNA Species Homo sapiens
Regulation Mechanism Overproduction of IL1B in the P-SIgA stimulated mesangial cells is regulated by miR-877-3p. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 qPCR [2]
Representative Target(s) Regulated by This miRNA Interleukin-1 beta (IL1B) Target Info
IL1B_HUMAN
Phospholipase D2 (PLD2) Target Info
PLD2_HUMAN
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [3]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism miR-21 inhibited the expression of IL1B constructs. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-877-3p miRNA Info
miRNA Mature AC
MIMAT0004950
Sequence uccucuucucccuccucccag
miRNA Species Homo sapiens
Regulation Mechanism Overproduction of IL1B was regulated by down-expression of miR-877-3p. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Interleukin-1 beta (IL1B) Target Info
IL1B_HUMAN
References  Top
REF 1 MiR-100-3p and miR-877-3p regulate overproduction of IL-8 and IL-1 in mesangial cells activated by secretory IgA from IgA nephropathy patients. Exp Cell Res. 2016 Oct 1;347(2):312-21.
REF 2 [Differential expression of miRNAs in myocardial tissues of rats with lipopolysaccharide- induced endotoxemia]. Nan Fang Yi Ke Da Xue Xue Bao. 2015 Feb;35(2):213-7.
REF 3 The Effects and Molecular Mechanisms of MiR-106a in Multidrug Resistance Reversal in Human Glioma U87/DDP and U251/G Cell Lines. PLoS One. 2015 May 7;10(5):e0125473.
REF 4 Induction of miR-21 by retinoic acid in estrogen receptor-positive breast carcinoma cells: biological correlates and molecular targets. J Biol Chem. 2011 Feb 4;286(5):4027-42.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.