Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T42247 |
Target Info
|
| Target Name |
Melanoma inhibitor of apoptosis protein (ML-IAP) |
| Synonyms |
UNQ5800/PRO19607/PRO21344; RNF50; RING-type E3 ubiquitin transferase BIRC7; RING finger protein 50; MLIAP; Livin; Kidney inhibitor of apoptosis protein; KIAP; Baculoviral IAP repeat-containing protein 7 |
| Target Type |
Patented-recorded Target |
| Gene Name |
BIRC7 |
| Biochemical Class |
Acyltransferase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-198 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
gguccagaggggagauagguuc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR198 down regulated BIRC7 expression by targeting its 3'UTR. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Dual Luciferase Reporter Assay |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Fibroblast growth factor receptor 1 (FGFR1)
|
Target Info
|
|
|
Janus kinase 3 (JAK-3)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA 198 suppresses prostate tumorigenesis by targeting MIB1. Oncol Rep. 2019 Sep;42(3):1047-1056.
|
| REF 2 |
Livin expression may be regulated by miR-198 in human prostate cancer cell lines. Eur J Cancer. 2013 Feb;49(3):734-40.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
