Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T43589 | Target Info | |||
| Target Name | High-affinity cationic amino acid transporter-1 (SLC7A1) | ||||
| Synonyms | System Y+ basic amino acid transporter; Solute carrier family 7 member 1; REC1L; High affinity cationic amino acid transporter 1; Ecotropic retrovirus receptor homolog; Ecotropic retroviral leukemia receptor homolog; CAT-1; ATRC1 | ||||
| Target Type | Literature-reported Target | ||||
| Gene Name | SLC7A1 | ||||
| Biochemical Class | Amino acid-polyamine-organocation | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-122-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uggagugugacaaugguguuug | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 4 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay; qRT-PCR | [2] | |||
| 3 | Luciferase Reporter Assay; Western Blot | [3] | |||
| 4 | Northern Blot | [4] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-W (BCL-W) | Target Info | |||
| Apoptosis regulator Bcl-xL (BCL-xL) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | Relief of microRNA-mediated translational repression in human cells subjected to stress. Cell. 2006 Jun 16;125(6):1111-24. | ||||
| REF 2 | MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. Hepatology. 2009 May;49(5):1571-82. | ||||
| REF 3 | miR-122, a mammalian liver-specific microRNA, is processed from hcr mRNA and may downregulate the high affinity cationic amino acid transporter CAT-1. RNA Biol. 2004 Jul;1(2):106-13. | ||||
| REF 4 | miR-122 targeting with LNA/2'-O-methyl oligonucleotide mixmers, peptide nucleic acids (PNA), and PNA-peptide conjugates. RNA. 2008 Feb;14(2):336-46. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.