Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T44991 Target Info
Target Name Vascular cell adhesion protein 1 (VCAM1)
Synonyms Vascular cell adhesion molecule 1; VCAM-1; V-CAM 1; INCAM-100; CD106 antigen; CD106
Target Type Literature-reported Target
Gene Name VCAM1
UniProt ID
P19320
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-126-3p by mature miRNA precursor transfection resulted in the decreased protein level of target VCAM1; The Underexpression by 2'-O-Me Antisense miRNA Oligonucleotides resulted in the increased protein level of target VCAM1. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; Northern Blot [1]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
References  Top
REF 1 MicroRNA-126 regulates endothelial expression of vascular cell adhesion molecule 1. Proc Natl Acad Sci U S A. 2008 Feb 5;105(5):1516-21.
REF 2 Endothelial enriched microRNAs regulate angiotensin II-induced endothelial inflammation and migration. Atherosclerosis. 2011 Apr;215(2):286-93.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.