Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T46871 Target Info
Target Name SH2 domain inositol 5'-phosphatase 1 (INPP5D)
Synonyms p150Ship; hp51CN; SIP145; SIP-145; SHIP1; SHIP-1; SHIP; SH2 domaincontaining inositol phosphatase 1; SH2 domaincontaining inositol 5'phosphatase 1; SH2 domain-containing inositol phosphatase 1; SH2 domain-containing inositol 5'-phosphatase 1; Phosphatidylinositol 3,4,5trisphosphate 5phosphatase 1; Phosphatidylinositol 3,4,5-trisphosphate 5-phosphatase 1; Inositol polyphosphate5phosphatase of 145 kDa; Inositol polyphosphate-5-phosphatase of 145 kDa
Target Type Clinical trial Target
Gene Name INPP5D
Biochemical Class Phosphoric monoester hydrolase
UniProt ID
Q92835
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism INPP5D is a direct downstream target of the miR-155. [5]
Evidence Score (E-score) 7 +
1 EMSA; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 GFP Reporter Assay; Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; Western Blot [4]
5 Luciferase Reporter Assay; Western Blot [5]
6 qRT-PCR; Luciferase Reporter Assay; Western Blot [6]
7 qRT-PCR; Western Blot [7]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
References  Top
REF 1 Pharmacological targeting of miR-155 via the NEDD8-activating enzyme inhibitor MLN4924 (Pevonedistat) in FLT3-ITD acute myeloid leukemia. Leukemia. 2015 Oct;29(10):1981-92.
REF 2 Aberrant overexpression of microRNAs activate AKT signaling via down-regulation of tumor suppressors in natural killer-cell lymphoma/leukemia. Blood. 2009 Oct 8;114(15):3265-75.
REF 3 MicroRNA 155 regulates Japanese encephalitis virus-induced inflammatory response by targeting Src homology 2-containing inositol phosphatase 1. J Virol. 2014 May;88(9):4798-810.
REF 4 MiR-155 induction by F. novicida but not the virulent F. tularensis results in SHIP down-regulation and enhanced pro-inflammatory cytokine response. PLoS One. 2009 Dec 30;4(12):e8508.
REF 5 Inositol phosphatase SHIP1 is a primary target of miR-155. Proc Natl Acad Sci U S A. 2009 Apr 28;106(17):7113-8.
REF 6 Onco-miR-155 targets SHIP1 to promote TNFalpha-dependent growth of B cell lymphomas. EMBO Mol Med. 2009 Aug;1(5):288-95.
REF 7 TanshinoneIIA ameliorates inflammatory microenvironment of colon cancer cells via repression of microRNA-155. Int Immunopharmacol. 2012 Dec;14(4):353-61.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.