Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T50224 |
Target Info
|
Target Name |
Ribosomal protein S6 kinase alpha-5 (RSK5) |
Synonyms |
S6K-alpha-5; RSKL; RSK-like protein kinase; Nuclear mitogen- and stress-activated protein kinase 1; MSK1; 90 kDa ribosomal protein S6 kinase 5 |
Target Type |
Patented-recorded Target |
Gene Name |
RPS6KA5 |
Biochemical Class |
Kinase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-148a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucagugcacuacagaacuuugu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
2 |
Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Activated leukocyte cell adhesionmolecule (ALCAM)
|
Target Info
|
|
Activin receptor-like kinase 2 (ALK-2)
|
Target Info
|
|
References |
Top |
REF 1 |
MiR-148a attenuates paclitaxel resistance of hormone-refractory, drug-resistant prostate cancer PC3 cells by regulating MSK1 expression. J Biol Chem. 2010 Jun 18;285(25):19076-84.
|
REF 2 |
miR 148 family members are putative biomarkers for sepsis. Mol Med Rep. 2019 Jun;19(6):5133-5141.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.