Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T51282 Target Info
Target Name Rho-associated protein kinase 1 (ROCK1)
Synonyms Rok; Rho-associated, coiled-coil containing protein kinase 1; Rho-associated kinase 1; Rho kinase; ROCK1; ROCK; P160ROCK; P160(rock); P160 ROCK-1; Let-502 kinase
Target Type Successful Target
Gene Name ROCK1
Biochemical Class Kinase
UniProt ID
Q13464
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-146a targeted ROCK1 directly and consequently actived caspase3 protein which exerted a critical role in cell apoptosis. [2]
Evidence Score (E-score) 3 +
1 Immunofluorescence; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
3 Western Blot; Northern Blot; Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-148b-3p miRNA Info
miRNA Mature AC
MIMAT0000759
Sequence ucagugcaucacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-148b is a major coordinator of breast cancer progression in a relapse-associated microRNA signature by targeting PIK3CA. [4]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [4]
2 Luciferase Reporter Assay; Western Blot [5]
3 Western Blot [6]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-144-5p miRNA Info
miRNA Mature AC
MIMAT0004600
Sequence ggauaucaucauauacuguaag
miRNA Species Homo sapiens
Regulation Mechanism miR-144 directly targets ROCK1. And ROCK1 is direct downstream target of miR-144 in OS cells. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [7]
2 qRT-PCR; Western Blot [8]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-E1 (CCNE1) Target Info
CCNE1_HUMAN
G1/S-specific cyclin-E2 (CCNE2) Target Info
CCNE2_HUMAN
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-148a in gastric cancer cells could reduce the mRNA and protein levels of ROCK1, whereas miR-148a silencing significantly increased ROCK1 expression. [9]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [9]
2 Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-335-5p miRNA Info
miRNA Mature AC
MIMAT0000765
Sequence ucaagagcaauaacgaaaaaugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [11]
2 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-300 miRNA Info
miRNA Mature AC
MIMAT0004903
Sequence uauacaagggcagacucucucu
miRNA Species Homo sapiens
Regulation Mechanism ROCK1 was the direct target of miR-300. [15]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [15]
Representative Target(s) Regulated by This miRNA Bromodomain-containing protein 7 (BRD7) Target Info
BRD7_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-340-5p miRNA Info
miRNA Mature AC
MIMAT0004692
Sequence uuauaaagcaaugagacugauu
miRNA Species Homo sapiens
Regulation Mechanism miR-340 acts as a tumor suppressor and its downregulation in tumor tissues may contribute to the progression and metastasis of osteosarcoma through a mechanism involving ROCK1, suggesting miR-340 as a potential new diagnostic and therapeutic target for the treatment of osteosarcoma. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-506-3p miRNA Info
miRNA Mature AC
MIMAT0002878
Sequence uaaggcacccuucugaguaga
miRNA Species Homo sapiens
Regulation Mechanism miR-506 acts as a tumor suppressor via regulation of ROCK1 expression and may thus be a promising therapeutic target for HCC. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-584-3p miRNA Info
miRNA Mature AC
MIMAT0022708
Sequence ucaguuccaggccaaccaggcu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Rho-associated protein kinase 1 (ROCK1) Target Info
ROCK1_HUMAN
miRNA Mature ID hsa-miR-584-5p miRNA Info
miRNA Mature AC
MIMAT0003249
Sequence uuaugguuugccugggacugag
miRNA Species Homo sapiens
Regulation Mechanism ROCK-1 is a direct target of miR-584. [19]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA Rho-associated protein kinase 1 (ROCK1) Target Info
ROCK1_HUMAN
References  Top
REF 1 MicroRNA-146a suppresses ROCK1 allowing hyperphosphorylation of tau in Alzheimer's disease. Sci Rep. 2016 May 25;6:26697.
REF 2 Hsa-miR-146a-5p modulates androgen-independent prostate cancer cells apoptosis by targeting ROCK1. Prostate. 2015 Dec;75(16):1896-903.
REF 3 Loss of mir-146a function in hormone-refractory prostate cancer. RNA. 2008 Mar;14(3):417-24.
REF 4 miR148b is a major coordinator of breast cancer progression in a relapse-associated microRNA signature by targeting ITGA5, ROCK1, PIK3CA, NRAS, and CSF1. FASEB J. 2013 Mar;27(3):1223-35.
REF 5 MicroRNA-148b targets Rho-associated protein kinase 1 to inhibit cell proliferation, migration and invasion in hepatocellular carcinoma. Mol Med Rep. 2016 Jan;13(1):477-82.
REF 6 Down-regulation of miR-21 biogenesis by estrogen action contributes to osteoclastic apoptosis. J Cell Biochem. 2013 Jun;114(6):1217-22.
REF 7 MicroRNA-144 suppresses osteosarcoma growth and metastasis by targeting ROCK1 and ROCK2. Oncotarget. 2015 Apr 30;6(12):10297-308.
REF 8 MicroRNA 44 inhibits migration and proliferation in rectal cancer by downregulating ROCK . Mol Med Rep. 2015 Nov;12(5):7396-402.
REF 9 MicroRNA-148a suppresses tumor cell invasion and metastasis by downregulating ROCK1 in gastric cancer. Clin Cancer Res. 2011 Dec 15;17(24):7574-83.
REF 10 MicroRNA-148a suppresses epithelial-to-mesenchymal transition by targeting ROCK1 in non-small cell lung cancer cells. Mol Cell Biochem. 2013 Aug;380(1-2):277-82.
REF 11 MicroRNA-335 is downregulated in bladder cancer and inhibits cell growth, migration and invasion via targeting ROCK1. Mol Med Rep. 2016 May;13(5):4379-85.
REF 12 miR-335 suppresses migration and invasion by targeting ROCK1 in osteosarcoma cells. Mol Cell Biochem. 2013 Dec;384(1-2):105-11.
REF 13 MicroRNA-126 inhibits tumor cell invasion and metastasis by downregulating ROCK1 in renal cell carcinoma. Mol Med Rep. 2016 Jun;13(6):5029-2036.
REF 14 ROCK1, a novel target of miR-145, promotes glioma cell invasion. Mol Med Rep. 2014 May;9(5):1877-82.
REF 15 MicroRNA-300 inhibited glioblastoma progression through ROCK1. Oncotarget. 2016 Jun 14;7(24):36529-36538.
REF 16 MicroRNA-340 suppresses osteosarcoma tumor growth and metastasis by directly targeting ROCK1. Biochem Biophys Res Commun. 2013 Aug 9;437(4):653-8.
REF 17 MiR-506 suppresses cell proliferation and tumor growth by targeting Rho-associated protein kinase 1 in hepatocellular carcinoma. Biochem Biophys Res Commun. 2015 Nov 27;467(4):921-7.
REF 18 MicroRNA-584-3p, a novel tumor suppressor and prognostic marker, reduces the migration and invasion of human glioma cells by targeting hypoxia-induced ROCK1. Oncotarget. 2016 Jan 26;7(4):4785-805.
REF 19 Tumour suppressor microRNA-584 directly targets oncogene Rock-1 and decreases invasion ability in human clear cell renal cell carcinoma. Br J Cancer. 2011 Jan 18;104(2):308-15.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.