Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T54646 |
Target Info
|
Target Name |
Transcription factor 7-like 2 (TCF7L2) |
Synonyms |
TCF4; TCF-4; T-cell-specific transcription factor 4; T-cell transcription factor-4; T-cell factor 4; HTCF-4; HMG box transcription factor 4 |
Target Type |
Literature-reported Target |
Gene Name |
TCF7L2 |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-26a-1-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ccuauucuugguuacuugcacg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-26a directly targets TCF7L2 crucial for insulin signaling and metabolism of lipid and glucose. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Caspase-3 (CASP3)
|
Target Info
|
|
References |
Top |
REF 1 |
MicroRNA-26a regulates insulin sensitivity and metabolism of glucose and lipids. J Clin Invest. 2015 Jun;125(6):2497-509.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.