Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T57278 | Target Info | |||
| Target Name | Ephrin type-A receptor 2 (EPHA2) | ||||
| Synonyms | Tyrosine-protein kinase receptor ECK; Epithelial cell kinase; EphA2receptor; ECK | ||||
| Target Type | Clinical trial Target | ||||
| Gene Name | EPHA2 | ||||
| Biochemical Class | Kinase | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-26b-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uucaaguaauucaggauaggu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-26b inhibits hepatocellular carcinoma cell proliferation, migration, and invasion by targeting EphA2. | [4] | |||
| Evidence Score (E-score) | 4 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [2] | |||
| 3 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [3] | |||
| 4 | Luciferase Reporter Assay; Western Blot | [4] | |||
| Representative Target(s) Regulated by This miRNA | ATP-binding cassette transporter A1 (ABCA1) | Target Info | |||
| Collagen I (COL1A2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-520d-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | aaagugcuucucuuuggugggu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | EphA2 Is a Direct Functional Target of miR-520d-3p. | [6] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot | [5] | |||
| 2 | Luciferase Reporter Assay; Western Blot | [6] | |||
| Representative Target(s) Regulated by This miRNA | Ephrin type-A receptor 2 (EPHA2) | Target Info | |||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | MicroRNA-26b Enhances the Radiosensitivity of Hepatocellular Carcinoma Cells by Targeting EphA2. Tohoku J Exp Med. 2016 Feb;238(2):143-51. | ||||
| REF 2 | miR-26b enhances radiosensitivity of hepatocellular carcinoma cells by targeting EphA2. Iran J Basic Med Sci. 2016 Aug;19(8):851-857. | ||||
| REF 3 | Role of microRNA-26b in glioma development and its mediated regulation on EphA2. PLoS One. 2011 Jan 14;6(1):e16264. | ||||
| REF 4 | MiR-26b inhibits hepatocellular carcinoma cell proliferation, migration, and invasion by targeting EphA2. Int J Clin Exp Pathol. 2015 May 1;8(5):4782-90. | ||||
| REF 5 | MicroRNA 520d-3p inhibits gastric cancer cell proliferation, migration, and invasion by downregulating EphA2 expression. Mol Cell Biochem. 2014 Nov;396(1-2):295-305. | ||||
| REF 6 | Therapeutic synergy between microRNA and siRNA in ovarian cancer treatment. Cancer Discov. 2013 Nov;3(11):1302-15. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.