Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T61243 |
Target Info
|
Target Name |
Metabotropic glutamate receptor 7 (mGluR7) |
Synonyms |
mGluR7; GPRC1G |
Target Type |
Literature-reported Target |
Gene Name |
GRM7 |
Biochemical Class |
GPCR glutamate |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-34a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggcagugucuuagcugguugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Mood stabilizers might upregulate GRM7 levels via miR-34a. |
[1] |
Evidence Score (E-score) |
2 |
+ |
1 |
qRT-PCR |
[1] |
2 |
Reporter Assay; Proteomics |
[2] |
Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
Androgen receptor (AR)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-34c-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aggcaguguaguuagcugauugc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Cyclin-dependent kinase 4 (CDK4)
|
Target Info
|
|
References |
Top |
REF 1 |
MicroRNAs in psychiatric and neurodevelopmental disorders. Brain Res. 2010 Jun 18;1338:78-88.
|
REF 2 |
Genome-wide characterization of miR-34a induced changes in protein and mRNA expression by a combined pulsed SILAC and microarray analysis. Mol Cell Proteomics. 2011 Aug;10(8):M111.010462.
|
REF 3 |
SOX11 identified by target gene evaluation of miRNAs differentially expressed in focal and non-focal brain tissue of therapy-resistant epilepsy patients. Neurobiol Dis. 2015 May;77:127-40.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.