Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T62292 Target Info
Target Name GABA(A) receptor alpha-3 (GABRA3)
Synonyms Gamma-aminobutyric acid receptor subunit alpha-3; GABA-A receptor alpha 3; GABA(A)Gamma-aminobutyric-acid receptor alpha-3 subunit precursor receptor; GABA(A) receptor subunit alpha-3
Target Type Successful Target
Gene Name GABRA3
Biochemical Class Neurotransmitter receptor
UniProt ID
P34903
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
MIMAT0000686
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Regulation Mechanism 3'UTR sequence of GABRA3 mRNA was identified as a target of hsa-miR-34c-5p. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
References  Top
REF 1 SOX11 identified by target gene evaluation of miRNAs differentially expressed in focal and non-focal brain tissue of therapy-resistant epilepsy patients. Neurobiol Dis. 2015 May;77:127-40.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.