Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T63414 Target Info
Target Name P2X purinoceptor 7 (P2RX7)
Synonyms Purinergic receptor 7; P2Z receptor; P2X7; Adenosine P2X7 receptor; ATP receptor
Target Type Clinical trial Target
Gene Name P2RX7
Biochemical Class ATP-gated P2X receptor cation channel
UniProt ID
Q99572
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-150-5p miRNA Info
miRNA Mature AC
MIMAT0000451
Sequence ucucccaacccuuguaccagug
miRNA Species Homo sapiens
Regulation Mechanism Transfections with mimics for miR-150 decreased P2RX7 activity. [2]
Evidence Score (E-score) 2 +
1 In Situ Hybridization; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Beta-arrestin-2 (ARRB2) Target Info
ARRB2_HUMAN
miRNA Mature ID hsa-miR-186-5p miRNA Info
miRNA Mature AC
MIMAT0000456
Sequence caaagaauucuccuuuugggcu
miRNA Species Homo sapiens
Regulation Mechanism Transfections with mimics for miR-186 decreased P2RX7 activity. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
Fibroblast growth factor-2 (FGF2) Target Info
FGF2_HUMAN
References  Top
REF 1 miR-150 promotes human breast cancer growth and malignant behavior by targeting the pro-apoptotic purinergic P2X7 receptor. PLoS One. 2013 Dec 2;8(12):e80707.
REF 2 MicroRNAs miR-186 and miR-150 down-regulate expression of the pro-apoptotic purinergic P2X7 receptor by activation of instability sites at the 3'-untranslated region of the gene that decrease steady-state levels of the transcript. J Biol Chem. 2008 Oct 17;283(42):28274-86.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.