Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T63484 |
Target Info
|
Target Name |
Glucose-6-phosphate dehydrogenase (G6PD) |
Synonyms |
Glucose-6-phosphate 1-dehydrogenase |
Target Type |
Successful Target |
Gene Name |
G6PD |
Biochemical Class |
CH-OH donor oxidoreductase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-206 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggaauguaaggaagugugugg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-206 targets G6PD in cancer cells and non-neoplastic fibroblast cells. |
[1] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
2 |
qPCR |
[2] |
Representative Target(s) Regulated by This miRNA |
Annexin A2 (ANXA2)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-1-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggaauguaaagaaguauguau
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
References |
Top |
REF 1 |
Transcription factor NRF2 regulates miR-1 and miR-206 to drive tumorigenesis. J Clin Invest. 2013 Jul;123(7):2921-34.
|
REF 2 |
MicroRNA-206 suppresses proliferation and predicts poor prognosis of HR-HPV-positive cervical cancer cells by targeting G6PD. Oncol Lett. 2018 Nov;16(5):5946-5952.
|
REF 3 |
Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.