Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T63595 Target Info
Target Name High mobility group protein B1 (HMGB1)
Synonyms High mobility group protein 1; High mobility group box chromosomal protein 1; HMG1; HMG-1
Target Type Literature-reported Target
Gene Name HMGB1
UniProt ID
P09429
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-142-3p miRNA Info
miRNA Mature AC
MIMAT0000434
Sequence uguaguguuuccuacuuuaugga
miRNA Species Homo sapiens
Regulation Mechanism miR-142-3p directly targets HMGB1 mRNA and inhibits its expression. [2]
Evidence Score (E-score) 2 +
1 ELISA; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
High mobility group protein B1 (HMGB1) Target Info
HMGB1_HUMAN
miRNA Mature ID hsa-miR-193a-3p miRNA Info
miRNA Mature AC
MIMAT0000459
Sequence aacuggccuacaaagucccagu
miRNA Species Homo sapiens
Regulation Mechanism miR-193a-3p targets the high mobility group box-1 (HMGB1). [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 Western Blot [4]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-200a-3p miRNA Info
miRNA Mature AC
MIMAT0000682
Sequence uaacacugucugguaacgaugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 ELISA; Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
2 ELISA; Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Regulation Mechanism HMGB1 mRNA was a direct target of the p53-induced miR-205. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism miR-22 directly targets HMGB1 by binding its UTR. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism miR-34a negatively regulates endogenous HMGB1 expression by binding to its 3'UTR. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
References  Top
REF 1 PPAR inhibits HMGB1 expression through upregulation of miR-142-3p in vitro and in vivo. Cell Signal. 2016 Mar;28(3):158-164.
REF 2 MiR-142-3p functions as a potential tumor suppressor directly targeting HMGB1 in non-small-cell lung carcinoma. Int J Clin Exp Pathol. 2015 Sep 1;8(9):10800-7.
REF 3 miR-193a-3p interaction with HMGB1 downregulates human endothelial cell proliferation and migration. Sci Rep. 2017 Mar 9;7:44137.
REF 4 miR-193a inhibits osteogenic differentiation of bone marrow-derived stroma cell via targeting HMGB1. Biochem Biophys Res Commun. 2018 Sep 5;503(2):536-543.
REF 5 The long non-coding RNA TP73-AS1 modulates HCC cell proliferation through miR-200a-dependent HMGB1/RAGE regulation. J Exp Clin Cancer Res. 2017 Apr 12;36(1):51.
REF 6 A Myc-microRNA network promotes exit from quiescence by suppressing the interferon response and cell-cycle arrest genes. Nucleic Acids Res. 2013 Feb 1;41(4):2239-54.
REF 7 p53-Regulated Networks of Protein, mRNA, miRNA, and lncRNA Expression Revealed by Integrated Pulsed Stable Isotope Labeling With Amino Acids in Cell Culture (pSILAC) and Next Generation Sequencing (NGS) Analyses. Mol Cell Proteomics. 2015 Oct;14(10):2609-29.
REF 8 Regulation of NF-B signaling by oxidized glycerophospholipid and IL-1 induced miRs-21-3p and -27a-5p in human aortic endothelial cells. J Lipid Res. 2015 Jan;56(1):38-50.
REF 9 Downregulation of HMGB1 by miR-34a is sufficient to suppress proliferation, migration and invasion of human cervical and colorectal cancer cells. Tumour Biol. 2016 Oct;37(10):13155-13166.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.