The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-155-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uuaaugcuaaucgugauagggguu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
2 |
Microarray |
[2] |
Representative Target(s) Regulated by This miRNA |
Acetyl-CoA transporter (SLC33A1)
|
Target Info
|
|
Angiotensin II receptor type-1 (AGTR1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-106a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aaaagugcuuacagugcagguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
P38 is a direct target of miR-106 and is responsible for the NSPC competence transition. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Immunocytochemistry; Immunohistochemistry |
[3] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-125a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucccugagacccuuuaaccuguga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-125a-5p directly targeted to p38 by using dual-luciferase assay. |
[4] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[4] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator BAK (BAK)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-141-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaacacugucugguaaagaugg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
3'UTR of MAPK14 was directly targeted by miR-141. |
[5] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
Bromodomain-containing protein 3 (BRD3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-17-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcuuacagugcagguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
P38 is a direct target of miR-17 and is responsible for the NSPC competence transition. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Immunocytochemistry; Immunohistochemistry |
[3] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-200a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaacacugucugguaacgaugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
3'UTR of MAPK14 was directly targeted by miR-200a. |
[5] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
Beta-catenin (CTNNB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-214-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acagcaggcacagacaggcagu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
In contrast to the observed alteration in p38MAPK in H23 cells upon miRNA-214 overexpression, a non-specific increase in both total p38MAPK and phosphorylation was found in U-1810 cells after miRNA-214 ablation. |
[6] |
Evidence Score (E-score) |
1 |
+ |
1 |
Microarray |
[6] |
Representative Target(s) Regulated by This miRNA |
Activating transcription factor 4 (ATF-4)
|
Target Info
|
|
ADP-ribosylation factor-like protein 2 (ARL2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-24-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggcucaguucagcaggaacag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[7] |
Representative Target(s) Regulated by This miRNA |
Activin receptor type IB (ACVR1B)
|
Target Info
|
|
Aurora kinase B (AURKB)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-27a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucacaguggcuaaguuccgc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-27a targets MAPK14 to regluate glucose metabolism in skeletal muscles. |
[8] |
Evidence Score (E-score) |
1 |
+ |
1 |
LacZ Reporter Assay |
[8] |
Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter A1 (ABCA1)
|
Target Info
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|