Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T66426 |
Target Info
|
Target Name |
Hematopoietic progenitor cell antigen CD34 (CD34) |
Synonyms |
CD34 molecule |
Target Type |
Clinical trial Target |
Gene Name |
CD34 |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-125a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucccugagacccuuuaaccuguga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
2 |
qRT-PCR |
[2] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator BAK (BAK)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-377-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aucacacaaaggcaacuuuugu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
PCR |
[3] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
DNA [cytosine-5]-methyltransferase 1 (DNMT1)
|
Target Info
|
|
References |
Top |
REF 1 |
Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. Proc Natl Acad Sci U S A. 2008 Mar 11;105(10):3945-50.
|
REF 2 |
An Exonic Switch Regulates Differential Accession of microRNAs to the Cd34 Transcript in Atherosclerosis Progression. Genes (Basel). 2019 Jan 21;10(1). pii: E70.
|
REF 3 |
Identification of apoptosis-related microRNAs and their target genes in myocardial infarction post-transplantation with skeletal myoblasts. J Transl Med. 2015 Aug 19;13:270.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.