Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T66538 |
Target Info
|
| Target Name |
Calcium-activated potassium channel KCa1.1 (KCNMA1) |
| Synonyms |
hSlo; Slowpoke homolog; Slo1; Slo-alpha; Slo homolog; SLO; MaxiK; Maxi K channel; KCa1.1; KCNMA; K(VCA)alpha; Calcium-activated potassium channel, subfamily M subunit alpha-1; Calcium-activated potassium channel subunit alpha-1; BKCA alpha; BK channel |
| Target Type |
Clinical trial Target |
| Gene Name |
KCNMA1 |
| Biochemical Class |
Voltage-gated ion channel |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-17-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
caaagugcuuacagugcagguag
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
KCNMA1 is a target of miR-17-5p. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunofluorescence |
[1] |
| 2 |
RT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-211-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uucccuuugucauccuucgccu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-211 was capable of specifically targeting the wild type seed sequence in the 3'UTR of the KCNMA1 transcript. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
LacZ Reporter Assay |
[3] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Calcium-activated potassium channel KCa1.1 (KCNMA1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
KCa1.1, a calcium-activated potassium channel subunit alpha 1, is targeted by miR-17-5p and modulates cell migration in malignant pleural mesothelioma. Mol Cancer. 2016 Jun 1;15(1):44.
|
| REF 2 |
KCNMA1 Expression is Downregulated in Colorectal Cancer via Epigenetic Mechanisms. Cancers (Basel). 2019 Feb 19;11(2). pii: E245.
|
| REF 3 |
The regulation of miRNA-211 expression and its role in melanoma cell invasiveness. PLoS One. 2010 Nov 1;5(11):e13779.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
