Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T66665 Target Info
Target Name Prostaglandin G/H synthase 2 (COX-2)
Synonyms Prostaglandin-endoperoxide synthase 2; Prostaglandin H2 synthase 2; PHS II; PGHS-2; PGH synthase 2; Cyclooxygenase-2; COX2; COX-2
Target Type Successful Target
Gene Name PTGS2
Biochemical Class Paired donor oxygen oxidoreductase
UniProt ID
P35354
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-26b-5p miRNA Info
miRNA Mature AC
MIMAT0000083
Sequence uucaaguaauucaggauaggu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Collagen I (COL1A2) Target Info
CO1A2_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-144-3p miRNA Info
miRNA Mature AC
MIMAT0000436
Sequence uacaguauagaugauguacu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [5]
2 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) Target Info
ATS1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism PTGS2 is the target of miR-204 and miR-204 expression decreased while PTGS2 mRNA levels increased. [7]
Evidence Score (E-score) 2 +
1 ELISA [7]
2 Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-101-3p miRNA Info
miRNA Mature AC
MIMAT0000099
Sequence uacaguacugugauaacugaa
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-101-3p by mature miRNA transfection resulted in the decreased protein level of target PTGS2. [9]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Enhancer of zeste homolog 2 (EZH2) Target Info
EZH2_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-146a targets PTGS2 gene. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-558 miRNA Info
miRNA Mature AC
MIMAT0003222
Sequence ugagcugcuguaccaaaau
miRNA Species Homo sapiens
Regulation Mechanism miR-558 reduced the luciferase activity by binding to COX-2 3'UTR indicating COX-2 is a target of miR-558. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Heparanase (HPSE) Target Info
HPSE_HUMAN
Prostaglandin G/H synthase 2 (COX-2) Target Info
PGH2_HUMAN
miRNA Mature ID hsa-miR-589-5p miRNA Info
miRNA Mature AC
MIMAT0004799
Sequence ugagaaccacgucugcucugag
miRNA Species Homo sapiens
Regulation Mechanism Introduction of miR-589 resulted in the increased protein and mRNA levels of COX-2. This increased expression of COX-2 further characterizes miR-589 as an endogenous activating factor in the nucleus. [12]
Evidence Score (E-score) 1 +
1 Western Blot [12]
Representative Target(s) Regulated by This miRNA Prostaglandin G/H synthase 2 (COX-2) Target Info
PGH2_HUMAN
References  Top
REF 1 MiRNA-26b inhibits proliferation by targeting PTGS2 in breast cancer. Cancer Cell Int. 2013 Feb 1;13(1):7.
REF 2 MiRNA-26b regulates the expression of cyclooxygenase-2 in desferrioxamine-treated CNE cells. FEBS Lett. 2010 Mar 5;584(5):961-7.
REF 3 Expression of miR-143 reduces growth and migration of human bladder carcinoma cells by targeting cyclooxygenase-2. Asian Pac J Cancer Prev. 2011;12(4):929-33.
REF 4 The toll-like receptor 3 ligand, poly(I:C), improves immunosuppressive function and therapeutic effect of mesenchymal stem cells on sepsis via inhibiting MiR-143. Stem Cells. 2014 Feb;32(2):521-33.
REF 5 MiR-26a and miR-144 inhibit proliferation and metastasis of esophageal squamous cell cancer by inhibiting cyclooxygenase-2. Oncotarget. 2016 Mar 22;7(12):15173-86.
REF 6 MicroRNA 144 3p may participate in the pathogenesis of preeclampsia by targeting Cox 2. Mol Med Rep. 2019 Jun;19(6):4655-4662.
REF 7 Pulmonary microRNA expression profiling in an immature piglet model of cardiopulmonary bypass-induced acute lung injury. Artif Organs. 2015 Apr;39(4):327-35.
REF 8 Identification of microRNAs inhibiting TGF--induced IL-11 production in bone metastatic breast cancer cells. PLoS One. 2012;7(5):e37361.
REF 9 MiR-101 downregulation is involved in cyclooxygenase-2 overexpression in human colon cancer cells. Exp Cell Res. 2009 May 1;315(8):1439-47.
REF 10 MicroRNA-146a negatively regulates PTGS2 expression induced by Helicobacter pylori in human gastric epithelial cells. J Gastroenterol. 2013 Jan;48(1):86-92.
REF 11 MicroRNA-558 regulates the expression of cyclooxygenase-2 and IL-1-induced catabolic effects in human articular chondrocytes. Osteoarthritis Cartilage. 2013 Jul;21(7):981-9.
REF 12 Promoter RNA links transcriptional regulation of inflammatory pathway genes. Nucleic Acids Res. 2013 Dec;41(22):10086-109.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.