The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-192-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cugaccuaugaauugacagcc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Overexpression of miR-192 inhibited cellular proliferation by binding DHFR. miR-192 decreased cellular anchoring via the repression of ITGAV. The posttranscriptional repression of DHFR is a consequence of miR-192 binding to binding seed sequences within the 3'UTR of its transcripts. In cells transfected with ITGAV 3'UTR-containing vectors, overexpression of miR-192 resulted in a significant reduction in luciferase activity. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Immunofluorescence; Luciferase Reporter Assay; Western Blot |
[1] |
2 |
Microarray |
[2] |
Representative Target(s) Regulated by This miRNA |
Activated leukocyte cell adhesionmolecule (ALCAM)
|
Target Info
|
|
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-92b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uauugcacucgucccggccucc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
ITGAV was a genuine target of miR-92b. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
CDK inhibitor 1C p57Kip2 (CDKN1C)
|
Target Info
|
|
Dickkopf-related protein 3 (DKK3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-548c-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaaaaucucaauuacuuuugc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-548c-3p directly targets the 3'UTR of ITGAV. |
[4] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Integrin alpha-V (ITGAV)
|
Target Info
|
|