Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T67103 Target Info
Target Name Integrin alpha-V (ITGAV)
Synonyms Vitronectin receptor subunit alpha; Vitronectin receptor alpha subunit; Vitronectin receptor; VTNR; VNRA; MSK8; CD51 antigen; CD51
Target Type Clinical trial Target
Gene Name ITGAV
Biochemical Class Integrin
UniProt ID
P06756
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
MIMAT0000222
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-192 inhibited cellular proliferation by binding DHFR. miR-192 decreased cellular anchoring via the repression of ITGAV. The posttranscriptional repression of DHFR is a consequence of miR-192 binding to binding seed sequences within the 3'UTR of its transcripts. In cells transfected with ITGAV 3'UTR-containing vectors, overexpression of miR-192 resulted in a significant reduction in luciferase activity. [2]
Evidence Score (E-score) 2 +
1 Immunofluorescence; Luciferase Reporter Assay; Western Blot [1]
2 Microarray [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-92b-3p miRNA Info
miRNA Mature AC
MIMAT0003218
Sequence uauugcacucgucccggccucc
miRNA Species Homo sapiens
Regulation Mechanism ITGAV was a genuine target of miR-92b. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
miRNA Mature ID hsa-miR-548c-3p miRNA Info
miRNA Mature AC
MIMAT0003285
Sequence caaaaaucucaauuacuuuugc
miRNA Species Homo sapiens
Regulation Mechanism miR-548c-3p directly targets the 3'UTR of ITGAV. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Integrin alpha-V (ITGAV) Target Info
ITAV_HUMAN
References  Top
REF 1 miR-192 suppresses leptomeningeal dissemination of medulloblastoma by modulating cell proliferation and anchoring through the regulation of DHFR, integrins, and CD47. Oncotarget. 2015 Dec 22;6(41):43712-30.
REF 2 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
REF 3 MicroRNA-92b represses invasion-metastasis cascade of esophageal squamous cell carcinoma. Oncotarget. 2016 Apr 12;7(15):20209-22.
REF 4 Decreased Expression of miR-548c-3p in Osteosarcoma Contributes to Cell Proliferation Via Targeting ITGAV. Cancer Biother Radiopharm. 2016 Jun;31(5):153-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.