Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T74363 Target Info
Target Name Urokinase plasminogen activator surface receptor (PLAUR)
Synonyms Urokinase-type plasminogen activator receptor; Urokinase plasminogen activator receptor; Monocyte activation antigenMo3; CD87 antigen; CD87
Target Type Successful Target
Gene Name PLAUR
UniProt ID
Q03405
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-335-5p miRNA Info
miRNA Mature AC
MIMAT0000765
Sequence ucaagagcaauaacgaaaaaugu
miRNA Species Homo sapiens
Regulation Mechanism miR-335 regulating the expression of PLAUR in AML cell lines directly targeting the 3'UTR of PLAUR-mRNA. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 qPCR [2]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-146a regulating the expression of PLAUR in AML cell lines directly targeting the 3'UTR of PLAUR-mRNA. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-622 miRNA Info
miRNA Mature AC
MIMAT0003291
Sequence acagucugcugagguuggagc
miRNA Species Homo sapiens
Regulation Mechanism miR-622 regulating the expression of PLAUR in AML cell lines directly targeting the 3'UTR of PLAUR-mRNA. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
Laminin gamma-2 subunit (LAMC2) Target Info
LAMC2_HUMAN
References  Top
REF 1 Urokinase receptor and CXCR4 are regulated by common microRNAs in leukaemia cells. J Cell Mol Med. 2015 Sep;19(9):2262-72.
REF 2 MicroRNA-335-5p is a potential suppressor of metastasis and invasion in gastric cancer. Clin Epigenetics. 2017 Oct 17;9:114.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.