Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T77127 Target Info
Target Name Vitamin D3 up-regulated protein 1 (VDUP1)
Synonyms Vitamin D(3) up-regulating protein-1; Thioredoxin-interacting protein; Thioredoxin-binding protein 2
Target Type Literature-reported Target
Gene Name TXNIP
Biochemical Class Arrestin protein
UniProt ID
Q9H3M7
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-373-3p miRNA Info
miRNA Mature AC
MIMAT0000726
Sequence gaagugcuucgauuuuggggugu
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
3 PAR-CLIP [3]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Cell surface protein HB15 (CD83) Target Info
CD83_HUMAN
miRNA Mature ID hsa-miR-372-3p miRNA Info
miRNA Mature AC
MIMAT0000724
Sequence aaagugcugcgacauuugagcgu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Microarray; qRT-PCR [4]
2 PAR-CLIP [3]
Representative Target(s) Regulated by This miRNA ATPase family AAA domain containing 2 (ATAD2) Target Info
ATAD2_HUMAN
B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism miR-204 directly targets and downregulate TXNIP. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-211-5p miRNA Info
miRNA Mature AC
MIMAT0000268
Sequence uucccuuugucauccuucgccu
miRNA Species Homo sapiens
Regulation Mechanism miR-211 directly target and downregulate TXNIP. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Calcium-activated potassium channel KCa1.1 (KCNMA1) Target Info
KCMA1_HUMAN
References  Top
REF 1 Global identification of miR-373-regulated genes in breast cancer by quantitative proteomics. Proteomics. 2011 Mar;11(5):912-20.
REF 2 MiR-373 drives the epithelial-to-mesenchymal transition and metastasis via the miR-373-TXNIP-HIF1-TWIST signaling axis in breast cancer. Oncotarget. 2015 Oct 20;6(32):32701-12.
REF 3 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 4 Specific alterations of the microRNA transcriptome and global network structure in colorectal cancer after treatment with MAPK/ERK inhibitors. J Mol Med (Berl). 2012 Dec;90(12):1421-38.
REF 5 Genome-wide identification of target genes for miR-204 and miR-211 identifies their proliferation stimulatory role in breast cancer cells. Sci Rep. 2016 Apr 28;6:25287.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.