Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T78890 Target Info
Target Name Tissue factor pathway inhibitor (TFPI)
Synonyms TFPI1; Lipoprotein-associated coagulation inhibitor; LACI; Extrinsic pathway inhibitor; EPI
Target Type Clinical trial Target
Gene Name TFPI
UniProt ID
P10646
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism miR-27a directly targets TFPI 3'UTR. [1]
Evidence Score (E-score) 2 +
1 ELISA; Luciferase Reporter Assay [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-494-3p miRNA Info
miRNA Mature AC
MIMAT0002816
Sequence ugaaacauacacgggaaaccuc
miRNA Species Homo sapiens
Regulation Mechanism miR-494 directly targets TFPI 3'UTR. [1]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 The role of microRNA-27a/b and microRNA-494 in estrogen-mediated downregulation of tissue factor pathway inhibitor . J Thromb Haemost. 2016 Jun;14(6):1226-37.
REF 2 Regulation of TFPI expression by miR-27a/b-3p in human endothelial cells under normal conditions and in response to androgens. Sci Rep. 2017 Feb 27;7:43500.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.